ID: 1034323402

View in Genome Browser
Species Human (GRCh38)
Location 7:150206358-150206380
Sequence CAGAGTCCTGTGTTTCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034323398_1034323402 20 Left 1034323398 7:150206315-150206337 CCTGGGAGTGCTTGTTCAACCTT No data
Right 1034323402 7:150206358-150206380 CAGAGTCCTGTGTTTCAAATAGG No data
1034323396_1034323402 22 Left 1034323396 7:150206313-150206335 CCCCTGGGAGTGCTTGTTCAACC No data
Right 1034323402 7:150206358-150206380 CAGAGTCCTGTGTTTCAAATAGG No data
1034323397_1034323402 21 Left 1034323397 7:150206314-150206336 CCCTGGGAGTGCTTGTTCAACCT No data
Right 1034323402 7:150206358-150206380 CAGAGTCCTGTGTTTCAAATAGG No data
1034323401_1034323402 1 Left 1034323401 7:150206334-150206356 CCTTGGTCTGTATCTAGGAGAAG No data
Right 1034323402 7:150206358-150206380 CAGAGTCCTGTGTTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034323402 Original CRISPR CAGAGTCCTGTGTTTCAAAT AGG Intergenic
No off target data available for this crispr