ID: 1034324659

View in Genome Browser
Species Human (GRCh38)
Location 7:150219974-150219996
Sequence TAGGATCTCCAGCCCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034324652_1034324659 -1 Left 1034324652 7:150219952-150219974 CCAGCCCAGCCGCAAAGCAGGGT No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data
1034324649_1034324659 3 Left 1034324649 7:150219948-150219970 CCTGCCAGCCCAGCCGCAAAGCA No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data
1034324655_1034324659 -6 Left 1034324655 7:150219957-150219979 CCAGCCGCAAAGCAGGGTAGGAT No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data
1034324656_1034324659 -10 Left 1034324656 7:150219961-150219983 CCGCAAAGCAGGGTAGGATCTCC No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data
1034324654_1034324659 -5 Left 1034324654 7:150219956-150219978 CCCAGCCGCAAAGCAGGGTAGGA No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data
1034324648_1034324659 29 Left 1034324648 7:150219922-150219944 CCTCGCAATCATGGGAAACAGCT No data
Right 1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034324659 Original CRISPR TAGGATCTCCAGCCCCAGGG TGG Intergenic
No off target data available for this crispr