ID: 1034324699

View in Genome Browser
Species Human (GRCh38)
Location 7:150220176-150220198
Sequence AGATGGAGGCTACAGTTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034324699_1034324718 30 Left 1034324699 7:150220176-150220198 CCCGCCAACTGTAGCCTCCATCT No data
Right 1034324718 7:150220229-150220251 GTCGCGGGTCTCTTACCTTGTGG No data
1034324699_1034324711 14 Left 1034324699 7:150220176-150220198 CCCGCCAACTGTAGCCTCCATCT No data
Right 1034324711 7:150220213-150220235 CGCACAAGCCCCCTCCGTCGCGG No data
1034324699_1034324712 15 Left 1034324699 7:150220176-150220198 CCCGCCAACTGTAGCCTCCATCT No data
Right 1034324712 7:150220214-150220236 GCACAAGCCCCCTCCGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034324699 Original CRISPR AGATGGAGGCTACAGTTGGC GGG (reversed) Intergenic
No off target data available for this crispr