ID: 1034330807

View in Genome Browser
Species Human (GRCh38)
Location 7:150280581-150280603
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034330807_1034330813 14 Left 1034330807 7:150280581-150280603 CCAGCATGGTGAGTACAGTTAGG 0: 2
1: 0
2: 1
3: 4
4: 101
Right 1034330813 7:150280618-150280640 TAGTGGAAATCTGCTGAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1034330807_1034330812 -3 Left 1034330807 7:150280581-150280603 CCAGCATGGTGAGTACAGTTAGG 0: 2
1: 0
2: 1
3: 4
4: 101
Right 1034330812 7:150280601-150280623 AGGAAGAGGGTACGGTGTAGTGG 0: 2
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034330807 Original CRISPR CCTAACTGTACTCACCATGC TGG (reversed) Intronic
900529477 1:3145640-3145662 CCTGACTGTACGGACCACGCAGG - Intronic
903928939 1:26851114-26851136 CTTAACTGCCCTCACCGTGCTGG + Exonic
904038071 1:27569323-27569345 ACTAATAGTACTCACCATGTAGG - Intronic
909643134 1:77888752-77888774 CCCAACTCTTCTCACCCTGCAGG - Exonic
912009624 1:104943340-104943362 CATAAGTGTACACACCATGGTGG + Intergenic
912083279 1:105966569-105966591 CTTAACTGTAGTCACCTTGCTGG + Intergenic
914945076 1:152057917-152057939 CCTAACTGTAAACTCCATGGTGG + Intergenic
917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG + Intronic
919958165 1:202439280-202439302 CCTCACTGTACTCACCCTGCTGG - Intronic
922111038 1:222555636-222555658 CTGAACTGTCATCACCATGCTGG - Intergenic
924834657 1:247636394-247636416 CCTCAATGTATTCACCATCCTGG + Intergenic
1075433790 10:122416114-122416136 CCTGACTCTCCTCAGCATGCCGG - Intronic
1077184480 11:1230110-1230132 CGTAGCTGCAGTCACCATGCAGG - Exonic
1083305139 11:61758112-61758134 CCCAACTGTACTCCCCACCCAGG - Intronic
1096912927 12:55002107-55002129 CCTCTCTGTGCTCACCATCCTGG - Intergenic
1098413552 12:70207362-70207384 ATTAACTGTAGTCACCATGTTGG + Intergenic
1101384516 12:104244960-104244982 CCTATCAATACTCACCATTCCGG - Intronic
1104910858 12:132240354-132240376 CCCCACTGTACACCCCATGCTGG + Intronic
1106974267 13:35188317-35188339 ATTAACTATAGTCACCATGCTGG + Intronic
1107130084 13:36885942-36885964 GCTGACTGTTCTCACTATGCGGG + Intronic
1111980110 13:95006304-95006326 CCTACCAGTCCTCACCCTGCAGG + Intergenic
1116036831 14:39637622-39637644 CCTAACTGTAATGACCATCGAGG - Intergenic
1117910214 14:60630060-60630082 CCTTACTGTATTCAGCATGTTGG - Intergenic
1118908343 14:70040180-70040202 ATTAACTATAGTCACCATGCTGG - Intergenic
1119310833 14:73645035-73645057 CCGAAAGGTACTCACCATTCCGG - Exonic
1124567043 15:30825791-30825813 CCTATCTGTACTGAGAATGCAGG - Intergenic
1125893847 15:43285955-43285977 CCTCTCTGAACTTACCATGCTGG - Intronic
1130386991 15:83420711-83420733 ATTAACTATAGTCACCATGCTGG + Intergenic
1130748140 15:86678183-86678205 ATTAACTATATTCACCATGCTGG + Intronic
1132068197 15:98750753-98750775 CTTAACTGTTCTCAGAATGCTGG - Intronic
1132713725 16:1280297-1280319 CCTGACTGTCCTCCCCATACAGG - Intergenic
1135012322 16:18892987-18893009 CCAAACTGTTTTCAACATGCAGG + Intronic
1135319184 16:21480230-21480252 CCAAACTGTTTTCAACATGCAGG + Intergenic
1135372080 16:21912023-21912045 CCAAACTGTTTTCAACATGCAGG + Intergenic
1135439706 16:22458681-22458703 CCAAACTGTTTTCAACATGCAGG - Intergenic
1135875004 16:26190574-26190596 CCAAAATTTACTCACCAAGCAGG + Intergenic
1136329484 16:29562303-29562325 CCAAACTGTTTTCAACATGCAGG + Intergenic
1136444112 16:30302010-30302032 CCAAACTGTTTTCAACATGCAGG + Intergenic
1138598102 16:58040175-58040197 GCCAGCTGTCCTCACCATGCAGG - Exonic
1142157050 16:88537418-88537440 CCCTACTGTCCCCACCATGCAGG + Intergenic
1144463409 17:15477310-15477332 ATTAACTGTGGTCACCATGCAGG - Intronic
1145248643 17:21285466-21285488 CCTCACTGTACCCCCTATGCGGG + Intronic
1150228096 17:63534614-63534636 CCAAACTGCACTCACCCTGGAGG + Intronic
1153341514 18:3979641-3979663 CTTAACTGTGGTTACCATGCAGG - Intronic
1156065237 18:33134836-33134858 CCTAATTGATCTGACCATGCTGG - Intronic
1158901620 18:61967337-61967359 GTTAACTGTACTCTCCAAGCTGG + Intergenic
1160027364 18:75229401-75229423 CCACACTGTATGCACCATGCAGG + Intronic
1163653719 19:18533317-18533339 CCTCACTGTACTCCCCCTGCTGG + Exonic
1163972939 19:20817735-20817757 CCTTACTGAAATCAACATGCAGG - Intronic
1166093975 19:40528333-40528355 CCTGACTGAACTGACCAGGCTGG - Intronic
928972989 2:37051449-37051471 TCTAGCTGTACTTACCATCCTGG + Intronic
929708897 2:44246083-44246105 GCCAACTGTATTCACCATCCAGG + Intergenic
932304994 2:70695706-70695728 CTGGACTGTACTCACCAGGCTGG + Exonic
933761403 2:85674730-85674752 CCTAACTGGACACTCCCTGCAGG + Intergenic
936984206 2:118292573-118292595 ACTAACTATAGTCACTATGCTGG + Intergenic
938213578 2:129489229-129489251 ATTAACTGTAGTCACCATGATGG + Intergenic
939261318 2:139813806-139813828 CCTAAATCTTCTCACCATTCAGG - Intergenic
947362263 2:229358172-229358194 CCTAACTCTACTCAGAAAGCCGG + Exonic
948012621 2:234662071-234662093 CCTAACTGTACAAATCATCCAGG - Intergenic
1174740284 20:53006555-53006577 CCAGTCTGTAGTCACCATGCAGG + Intronic
1178459992 21:32794253-32794275 CCAAACTGTAGTCACAATCCCGG + Exonic
1179012809 21:37569373-37569395 CCTAACTGTACTCCTCCTGAGGG + Intergenic
1179177413 21:39018983-39019005 CATAACTGTACTCACCGATCAGG + Intergenic
1179377144 21:40860630-40860652 CTGATCTGAACTCACCATGCAGG + Intergenic
1180088711 21:45523165-45523187 CCCAGCTGTTCTCCCCATGCTGG + Intronic
1182155293 22:28066393-28066415 GTTAACTATAGTCACCATGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
956281158 3:67558507-67558529 CCTCACTGTTCTTACCCTGCTGG + Intronic
960446378 3:117753937-117753959 ACTACCTGTCCTCACCCTGCAGG + Intergenic
961867820 3:129966790-129966812 CCTAACTGTCCTCATCCTTCAGG + Intergenic
965405438 3:168262367-168262389 CTTAAATGTTCTCACCATGGGGG + Intergenic
970263149 4:14250923-14250945 CCTCATTGTTCTCACCATGTTGG - Intergenic
974724447 4:65780531-65780553 CCTAACAGTTCTCTCCATTCTGG - Intergenic
980843689 4:138298280-138298302 ACTAACTGTTCACAGCATGCTGG - Intergenic
981331061 4:143511251-143511273 CTTAAATGTTCTCACCATGCTGG + Intergenic
986425183 5:7624325-7624347 CCTAACTGTACTCTCCAAATAGG - Intronic
987211441 5:15687677-15687699 CCTCACTGTCCTCACTGTGCAGG - Intronic
988682467 5:33497374-33497396 CCATGCTGTACTCAACATGCAGG + Intergenic
998119246 5:139562057-139562079 CCTAAGAGTCCACACCATGCGGG - Intronic
1000297501 5:159924914-159924936 GCTTACTGTGCTCTCCATGCTGG + Intronic
1003173569 6:3738495-3738517 CCTGACTGTAGCCACCACGCTGG - Intronic
1007794955 6:44339732-44339754 CCCAACTGTGCTCACCCTCCCGG + Intronic
1010032392 6:71284940-71284962 CTTAACTGAACTCTTCATGCAGG - Intergenic
1012793367 6:103729521-103729543 CATAAGTGTACACACCATGGTGG + Intergenic
1017898408 6:158701088-158701110 CATGACTGTCCTCACCAGGCTGG - Intronic
1017990429 6:159483228-159483250 GCCAGCTGCACTCACCATGCTGG - Intergenic
1019298886 7:293208-293230 CATACGTGTACACACCATGCTGG - Intergenic
1021316900 7:19158783-19158805 CCTAACTGTTCTCAGTATGAGGG + Intergenic
1027659255 7:80969392-80969414 ACTAACTATAGTCACCATGTTGG - Intergenic
1032146272 7:129383920-129383942 TGTAACTATAGTCACCATGCTGG - Intronic
1033273757 7:139955835-139955857 CCCAACCGTTCTCACCATGGCGG - Intronic
1034130713 7:148714396-148714418 ATTAACTGGAGTCACCATGCTGG + Intronic
1034330807 7:150280581-150280603 CCTAACTGTACTCACCATGCTGG - Intronic
1034667236 7:152829268-152829290 CCTAACTGTACTCACCATGCTGG + Intronic
1035472022 7:159116407-159116429 CCCAAATGCACTGACCATGCGGG - Intronic
1037865597 8:22440514-22440536 ACTAACTGCACTCAACAAGCGGG + Intergenic
1041581747 8:59468483-59468505 CCAACATGTGCTCACCATGCAGG + Intergenic
1048278517 8:133086928-133086950 CCTAAATGTAATTAGCATGCTGG + Intronic
1052818564 9:33121207-33121229 CCTCACAGTGCTCACCATGGAGG + Intronic
1059964643 9:119601776-119601798 CCCTCCTGTACTCATCATGCAGG + Intergenic
1190507466 X:51140462-51140484 GCTAACTGTAGTCACCCTACTGG + Intergenic
1192304965 X:69949612-69949634 CCTTAGTGTACTCTCCATGATGG + Intronic
1194524137 X:94956703-94956725 GCTAACTATACTCACCCTACTGG - Intergenic
1195422754 X:104693996-104694018 CCCAACTGTTCTCACCCTGTTGG + Intronic
1197255150 X:124254872-124254894 CCTAACTTTACTAACCATGTAGG + Intronic
1198333990 X:135649673-135649695 CATAATTATACTAACCATGCGGG + Intergenic
1201853011 Y:18508903-18508925 CCATACTGTACCCGCCATGCTGG - Intergenic
1201880310 Y:18811481-18811503 CCATACTGTACCCGCCATGCTGG + Intronic