ID: 1034335976

View in Genome Browser
Species Human (GRCh38)
Location 7:150323632-150323654
Sequence GGCACCGCTGGCCCAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 481}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034335976_1034335985 17 Left 1034335976 7:150323632-150323654 CCACCTGCTGGGCCAGCGGTGCC 0: 1
1: 0
2: 2
3: 49
4: 481
Right 1034335985 7:150323672-150323694 TGGGAGAGGCCAGAATCTTCCGG 0: 1
1: 0
2: 2
3: 14
4: 219
1034335976_1034335983 3 Left 1034335976 7:150323632-150323654 CCACCTGCTGGGCCAGCGGTGCC 0: 1
1: 0
2: 2
3: 49
4: 481
Right 1034335983 7:150323658-150323680 GCGCCGAAACACACTGGGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1034335976_1034335979 -3 Left 1034335976 7:150323632-150323654 CCACCTGCTGGGCCAGCGGTGCC 0: 1
1: 0
2: 2
3: 49
4: 481
Right 1034335979 7:150323652-150323674 GCCCTCGCGCCGAAACACACTGG 0: 1
1: 0
2: 0
3: 1
4: 27
1034335976_1034335981 -2 Left 1034335976 7:150323632-150323654 CCACCTGCTGGGCCAGCGGTGCC 0: 1
1: 0
2: 2
3: 49
4: 481
Right 1034335981 7:150323653-150323675 CCCTCGCGCCGAAACACACTGGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034335976 Original CRISPR GGCACCGCTGGCCCAGCAGG TGG (reversed) Intronic
900364128 1:2303891-2303913 CGCACCGCCGGCCCAGCAGAAGG + Exonic
900657006 1:3763380-3763402 GGAGCTGCTGGCCCAGCTGGAGG + Exonic
901237061 1:7672864-7672886 GGGAGGGCTGGGCCAGCAGGGGG - Intronic
901946180 1:12705961-12705983 GGCACCGCAGGACCAGAAGGTGG + Intergenic
902944572 1:19825529-19825551 GGCACTGCTGGGCCTGCAGGTGG + Intergenic
903148107 1:21387994-21388016 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
903526312 1:23994331-23994353 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
903923607 1:26818081-26818103 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
904077383 1:27853030-27853052 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
904788025 1:32997134-32997156 TGCACTGCTTGCCCAGCATGGGG + Intergenic
904795007 1:33051950-33051972 GGCACGGCTGGCCGGGCGGGGGG - Intronic
904795028 1:33051999-33052021 GGCACGGCTGGCCAGGCGGGGGG - Intronic
905172973 1:36119870-36119892 GGCACTGCTGGCCCAGCTCATGG + Intronic
905173308 1:36121902-36121924 GGCACTGCTGGCCCAGCTCATGG - Intronic
905216580 1:36412610-36412632 GGCACTGCTGGCACTGCTGGTGG + Intergenic
905358320 1:37400554-37400576 GGCAGGGATGGCCCAGCTGGAGG - Intergenic
906087537 1:43148640-43148662 GGCACCTCAGACCCAGCAGGAGG + Intronic
906486838 1:46241110-46241132 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
906486861 1:46241159-46241181 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
906898200 1:49802711-49802733 GGCACCACGGGACCAGAAGGCGG + Intronic
906961012 1:50419479-50419501 GGCAGCGCTGGCCCTGGCGGCGG - Exonic
907050796 1:51329086-51329108 GGCACCTCTGGCCCTGCTGCAGG - Intronic
907269969 1:53285284-53285306 GGCACCACTGGCCCAGAGAGAGG + Intronic
907453745 1:54562470-54562492 GGCACGGCTGGCCAGGCGGGGGG + Intronic
910343844 1:86216073-86216095 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
910406789 1:86899392-86899414 GGGACGGCTGGCCGGGCAGGGGG + Intronic
910977168 1:92918924-92918946 GCCACCGCTGATCCGGCAGGAGG + Intronic
912298440 1:108489807-108489829 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
912298460 1:108489856-108489878 GGCACGGCTGGCCGGGCAGGGGG + Intergenic
912825298 1:112898682-112898704 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
912844868 1:113069473-113069495 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
913100890 1:115564358-115564380 GGCACCTCTCGCCCAGGAAGGGG - Intergenic
913306154 1:117430235-117430257 GGCACGGCTGGCCAGGCGGGGGG + Intronic
913537422 1:119786344-119786366 GGCACCACAGGACCAGAAGGCGG - Intergenic
914957759 1:152179722-152179744 GGCAGCTCTGGCCCAGGAAGAGG - Intergenic
915465697 1:156096771-156096793 GTCTCCGCTGGGCCAGCAGGTGG + Intronic
915472593 1:156134903-156134925 GGAACTGCGGGCCCAGCATGAGG + Exonic
915512715 1:156395177-156395199 GGCCCAGCTGGCCCAGCAGGAGG + Intergenic
917237739 1:172912881-172912903 GGCACACCTGGCCCAGCTGCAGG - Intergenic
918228702 1:182509694-182509716 GGCACGGCTGGCCGGGCGGGGGG + Intronic
918481472 1:184982327-184982349 ATCATCGGTGGCCCAGCAGGTGG - Intergenic
919205431 1:194416602-194416624 AGCACCGCAGGACCAGAAGGCGG + Intergenic
919797028 1:201327043-201327065 AGCACTGCTGGCCAAGCAAGGGG + Intronic
920350645 1:205335817-205335839 GGAAATGCTGGGCCAGCAGGTGG + Intergenic
920920300 1:210292656-210292678 GGCACAGGTGTCCCAGGAGGGGG + Intergenic
921414260 1:214869787-214869809 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
923207220 1:231770951-231770973 GGGACAGCTGGCCCACCAGTGGG - Exonic
923710849 1:236386883-236386905 GGCACGGCTGGCCGGGCGGGGGG - Intronic
924230390 1:241957778-241957800 GGCAGCGCTGGCACAGGAAGCGG - Intergenic
1062764081 10:48214-48236 AGCACCGTTCGCCCTGCAGGTGG + Intronic
1062799544 10:368971-368993 GGCACGGCGGGCCCTGCAGCTGG + Intronic
1062960327 10:1568346-1568368 AGCACCGATGGTCCAGCCGGAGG + Intronic
1064144807 10:12819185-12819207 GGCACAGAGGGCCCAGCAGGAGG + Intronic
1064222671 10:13455335-13455357 AGCACGGCTGGCCAGGCAGGAGG + Intronic
1064663547 10:17629182-17629204 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1068418896 10:56763234-56763256 GGCACTCCTGGCCCAGCTGTGGG + Intergenic
1068719083 10:60222244-60222266 GGCAGCGCTGGCCCAGCTGCTGG + Intronic
1069531518 10:69222961-69222983 GGCACCGCTGGCCCAGGATCTGG - Intronic
1070318082 10:75333612-75333634 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1070318104 10:75333661-75333683 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1072116592 10:92375167-92375189 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1072116615 10:92375216-92375238 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1072149974 10:92675342-92675364 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1072149997 10:92675391-92675413 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1072336656 10:94403481-94403503 GGCACCGGCGGCCCCGCCGGGGG - Exonic
1072409038 10:95183748-95183770 GGCCCCGCCGCCCCAGCAGGGGG + Intergenic
1072648258 10:97275714-97275736 GGCACAGCTGGCCGGGCGGGGGG - Intronic
1072949571 10:99838709-99838731 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1072980236 10:100093150-100093172 GGCACGGCTGGCCGGGCAGGGGG - Intergenic
1073122621 10:101131782-101131804 GGCCCCGGAGGCCCGGCAGGCGG + Exonic
1074323101 10:112421675-112421697 GGCACCTCCTGCCCAGCAGATGG - Intronic
1075557608 10:123444749-123444771 GGCACCGCTGGGCCTGAAGAGGG + Intergenic
1076096344 10:127737240-127737262 GGCACCGCTGGCCCAGGCCCGGG + Exonic
1076329471 10:129654031-129654053 GGCACAGCTGGCCCAGAGCGAGG + Intronic
1076351165 10:129816101-129816123 GTCCCGGCTGGCCCGGCAGGAGG - Intergenic
1076803903 10:132845753-132845775 GGCACTGCTGGCCCATCTGCTGG + Intronic
1076878904 10:133230585-133230607 GGCCGCGCTGGCCCAGCAGCAGG + Exonic
1076943158 10:133623280-133623302 GGTCCCGCTGGCCCTGGAGGCGG + Intergenic
1077018387 11:406881-406903 GGCGGTGCTGGCGCAGCAGGCGG + Exonic
1077090963 11:777940-777962 GGCTCCGCCGGCCCAGGACGGGG + Intronic
1077169136 11:1158647-1158669 GGAACTGCTGGCCCAGCAAGGGG - Intronic
1077208991 11:1359633-1359655 GAGCCCGCTGCCCCAGCAGGAGG + Intergenic
1077213182 11:1382883-1382905 GACACCTCTGGCCCAGCCGTAGG - Intergenic
1077421294 11:2451336-2451358 GCCACCGCTGATCCAACAGGAGG + Intronic
1077516548 11:3005482-3005504 GGCAGGGCTGGCCCCGCAGTGGG - Intronic
1078106331 11:8360301-8360323 GGTTCCTCTGGCCCAGCAGAAGG + Intergenic
1079039815 11:17050565-17050587 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1079911510 11:26316242-26316264 GGCATCGCAGGACCAGAAGGCGG - Intronic
1080097990 11:28430287-28430309 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1080098011 11:28430336-28430358 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1080098312 11:28431040-28431062 GGGGCCGCTGGCCGGGCAGGGGG - Intergenic
1081289115 11:41304930-41304952 GGGGCGGCTGGCCCAGCAGGTGG - Intronic
1081656365 11:44860237-44860259 GGCTCTCCTGGCCCTGCAGGAGG - Intronic
1081784769 11:45738538-45738560 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1083382353 11:62278891-62278913 GGCACAGCTGGCCGGGCGGGGGG - Intergenic
1083646136 11:64172483-64172505 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1084601307 11:70147421-70147443 GCCACAGGGGGCCCAGCAGGAGG - Intronic
1084769500 11:71333621-71333643 GGCACTGCTGGCCCACCAAGAGG + Intergenic
1084979593 11:72822089-72822111 GGCGCAGCAGGCCCAGCAGGTGG + Exonic
1085412082 11:76297344-76297366 GGCCCCCCTGGCCCAGCAGAGGG - Intergenic
1085513321 11:77098755-77098777 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1085784890 11:79440343-79440365 TGCTCCCCTGGCCCAGGAGGAGG - Intronic
1086957572 11:92949357-92949379 GGCACTGCGGGACCAGAAGGCGG - Intergenic
1087057335 11:93947322-93947344 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1087579352 11:100031918-100031940 GGCACCACGGGACCAGAAGGTGG + Intronic
1088893913 11:114063958-114063980 GGCTCCTCGGGCCCTGCAGGTGG - Exonic
1089655142 11:119941748-119941770 GGGCCTGCTGACCCAGCAGGAGG - Intergenic
1090213043 11:124936272-124936294 GGCACCGGCAGCCCAGCAGTTGG + Exonic
1090322964 11:125863178-125863200 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1090791103 11:130091746-130091768 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1091758529 12:3072049-3072071 GGTACTGCTGGGCCAGAAGGTGG - Intergenic
1092259733 12:6946431-6946453 GGCGGCCCTGGACCAGCAGGCGG + Intergenic
1095068767 12:37814944-37814966 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1095092907 12:38123567-38123589 GGCATCGCAGGACCAGAAGGCGG + Intergenic
1095296368 12:40531738-40531760 GGCACCTCTGTCACACCAGGGGG + Intronic
1095439520 12:42227807-42227829 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1096022289 12:48333120-48333142 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1096022312 12:48333169-48333191 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1096515201 12:52151918-52151940 GGCTCCCCTTGCCCAGGAGGTGG - Intergenic
1098162482 12:67658499-67658521 GGCACCCCTGGCTGAGGAGGCGG + Exonic
1098747676 12:74260726-74260748 GGCACTGCGGGACCAGAAGGTGG + Intergenic
1099078379 12:78141806-78141828 GGCAGTGCTGGCCCAACAGGAGG - Intronic
1101874468 12:108589457-108589479 GGCAGCCCTGGCCCTGCAGTCGG - Intergenic
1101967511 12:109291536-109291558 GGCAGAGCTGGCCAAGCAGATGG - Intronic
1102469536 12:113152002-113152024 GGCCCTGCAGGCCCAGAAGGAGG + Exonic
1102634042 12:114307102-114307124 GTCACCCCTGCCCCAGCCGGTGG - Intergenic
1103492287 12:121331400-121331422 GGCAGAGCTCGCCCTGCAGGAGG - Exonic
1103562397 12:121799677-121799699 GGCCCCGGCGGCCCAGCAGGCGG + Intronic
1104139626 12:125974884-125974906 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1104923166 12:132301575-132301597 TTCACCGCCGGCACAGCAGGAGG + Intronic
1105356581 13:19664729-19664751 GGCACGGCTGGCAGAGCTGGGGG + Intronic
1105367758 13:19779341-19779363 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1105986368 13:25571197-25571219 TGCACAGCTTCCCCAGCAGGCGG - Intronic
1106249406 13:27972234-27972256 GGCTTCTCTGGCCCAGCAGCAGG - Intergenic
1106303193 13:28487979-28488001 GACACCGATGTCCCAGCAGAAGG + Intronic
1106503970 13:30355514-30355536 GGCATATATGGCCCAGCAGGGGG + Intergenic
1106918641 13:34540802-34540824 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1108351382 13:49593111-49593133 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1109105249 13:58241828-58241850 GGCACTGCAGGACCAGAAGGTGG + Intergenic
1110269365 13:73574914-73574936 GGCACGGCTGGCCAGGCCGGGGG - Intergenic
1113378393 13:109783925-109783947 GGCCCCGCAGGCCCCGCAGAAGG + Exonic
1113586835 13:111471544-111471566 GGCACGGCTGGCACAGCATAAGG + Intergenic
1113962242 13:114132540-114132562 GGCAGCTCAGGCCGAGCAGGAGG + Exonic
1114568658 14:23650343-23650365 GGCTGGGCTCGCCCAGCAGGAGG + Intergenic
1114659124 14:24333775-24333797 GGCAGCGCTCGAGCAGCAGGGGG + Intronic
1115609722 14:35039140-35039162 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1115609745 14:35039189-35039211 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1116480403 14:45389330-45389352 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1116480426 14:45389379-45389401 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1119710869 14:76821786-76821808 GGGGCGGCTGGCCCAGCAGAGGG - Intronic
1119737442 14:76992525-76992547 GTCTCTGCTGGCCCAACAGGAGG - Intergenic
1119878955 14:78085002-78085024 GGCACAGGCTGCCCAGCAGGTGG + Intergenic
1121049149 14:90808880-90808902 GGCACAGCTGGCCGGGCAGCTGG + Intronic
1121306734 14:92911721-92911743 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1121758359 14:96422042-96422064 GGCACCACGGGACCAGAAGGCGG - Intronic
1122963866 14:105112143-105112165 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1123213652 14:106785357-106785379 GGCCCTGCAGGCCCAGCAGGAGG - Intergenic
1123783355 15:23646806-23646828 AGCACCGATGGCACAGCCGGCGG - Exonic
1125079229 15:35656200-35656222 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1125659192 15:41382567-41382589 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1125659215 15:41382616-41382638 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1127072989 15:55303094-55303116 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1127964803 15:63915606-63915628 GGCACTGCTGGGCCAGGAGGAGG - Intronic
1128145544 15:65330649-65330671 GCCCCGGCTGGCCCAGCACGAGG - Exonic
1128353915 15:66911243-66911265 GGCACCGCAGGCTCACCCGGTGG + Intergenic
1128550845 15:68596970-68596992 AGCCCTGCTGGCCCTGCAGGAGG - Intronic
1129428447 15:75481400-75481422 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1129428470 15:75481449-75481471 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1130340771 15:82998195-82998217 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1130966501 15:88701259-88701281 GGCACCCCTGGGCCAGGTGGAGG - Intergenic
1131001400 15:88941863-88941885 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1131076187 15:89496328-89496350 GCCTCCGCTGGGCCTGCAGGCGG + Intronic
1131125271 15:89854081-89854103 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1131440509 15:92456101-92456123 GTCCCCTGTGGCCCAGCAGGAGG - Intronic
1131755032 15:95550413-95550435 GGCACTGCTGCCCCACCAGCCGG + Intergenic
1132662093 16:1066114-1066136 GGCTCCCCAAGCCCAGCAGGTGG - Intergenic
1132776795 16:1599383-1599405 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1132776817 16:1599432-1599454 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1134450501 16:14360538-14360560 TGCATAGCTGGCCCAGGAGGCGG - Intergenic
1135413841 16:22254240-22254262 GAGCCCTCTGGCCCAGCAGGTGG + Intronic
1135721635 16:24822817-24822839 GTCACCGCGGGCCCTCCAGGAGG - Intronic
1136550251 16:30979192-30979214 GGGGCCGGGGGCCCAGCAGGTGG - Exonic
1137442884 16:48511147-48511169 GGCTCCTCTGGCCCAGCATCAGG - Intergenic
1137622546 16:49885637-49885659 TGCACCACTGTCCCAGCATGTGG - Intergenic
1138437539 16:57012538-57012560 GGCACCGCTGATCCGACAGGAGG - Intronic
1139545081 16:67646248-67646270 GGAACAGCTGGCCCAGCACGTGG + Exonic
1139864286 16:70051341-70051363 GGGGCGGCTGGCCCGGCAGGGGG - Intergenic
1141560931 16:84867351-84867373 GGAAGCGCTGGCCCTGCAGAGGG + Intronic
1141828142 16:86495102-86495124 AGGGCGGCTGGCCCAGCAGGAGG + Intergenic
1142204099 16:88774576-88774598 GGCATCGCTGGCCCAGCTGCAGG + Intronic
1142272660 16:89098683-89098705 GGCACAGCTGCTTCAGCAGGTGG - Exonic
1142419489 16:89961718-89961740 GGCCCCTCTGACCCTGCAGGGGG + Exonic
1142440572 16:90095013-90095035 AGCACCACTCGCCCTGCAGGTGG - Intergenic
1142602071 17:1058459-1058481 GGCACAGCTGACCTTGCAGGAGG + Intronic
1142614073 17:1124975-1124997 GGCAGCGTTGGCAAAGCAGGTGG + Intronic
1143154501 17:4827639-4827661 GGCACCCCTGGCCCAGCCTGGGG - Intergenic
1144481986 17:15637181-15637203 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1144565075 17:16353217-16353239 GTCGCCGCGGGCCCAGGAGGAGG - Exonic
1144713597 17:17419417-17419439 GCCACTGCTGACCCAACAGGAGG - Intergenic
1145047222 17:19627921-19627943 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1145205850 17:20984650-20984672 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1145205874 17:20984700-20984722 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1146061050 17:29607626-29607648 GGCAGAGCAGCCCCAGCAGGGGG + Intronic
1147137827 17:38444264-38444286 GCCAGCGCTGGGCCAGCAGGGGG + Intronic
1147145468 17:38482161-38482183 GCCAGAGCAGGCCCAGCAGGGGG + Intronic
1147419801 17:40316872-40316894 GACAGCTCCGGCCCAGCAGGCGG + Intronic
1147539097 17:41341949-41341971 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1147963358 17:44180614-44180636 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1147963381 17:44180663-44180685 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1148262178 17:46193328-46193350 GCCACCGCTCGCCGAGCCGGCGG - Intronic
1148772706 17:50076400-50076422 GGGACCGCAGCCCCAGCCGGGGG - Exonic
1149561788 17:57612565-57612587 CTCACCGTTGACCCAGCAGGTGG + Intronic
1149908912 17:60551484-60551506 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1149908934 17:60551533-60551555 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1150414553 17:64976167-64976189 GGCACCGCGGGGCCAGCATTAGG + Intergenic
1151753585 17:76057105-76057127 GTCACATTTGGCCCAGCAGGTGG - Intronic
1152397126 17:80040241-80040263 GTCACCTCTGGGCCAGCAGTGGG + Exonic
1152412333 17:80133839-80133861 GGCACTGCTGGCCGAGCGGGAGG - Intergenic
1152829849 17:82490565-82490587 GGCCCTGCTGGGGCAGCAGGTGG - Intergenic
1155209355 18:23587051-23587073 TGCGCAGCTGGGCCAGCAGGTGG - Intergenic
1155479732 18:26272300-26272322 GGCACCGCTGGCCTGACAGGAGG + Intronic
1157639894 18:49202964-49202986 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1157677204 18:49577673-49577695 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1157677226 18:49577722-49577744 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1157677349 18:49577998-49578020 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1157677372 18:49578047-49578069 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1158148597 18:54343380-54343402 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1159152564 18:64538746-64538768 GGCAATGCAGGCCCAGCAGCAGG - Intergenic
1160579047 18:79873386-79873408 GGCACCCGTGGGCCAGCACGGGG - Intronic
1160725468 19:616208-616230 GGCAGGGCGGGCCCAGCAAGGGG - Exonic
1160793287 19:932777-932799 GGCCCCACTGGCCCAGGAGCAGG - Intronic
1160804112 19:984254-984276 GGCCCCGCGGCCCCAGCGGGTGG - Exonic
1161031552 19:2060020-2060042 GGCAGGGCTGGCCCAGGAGATGG + Intergenic
1161428569 19:4217659-4217681 GGCCGAGCTGGCCCAGCGGGAGG + Exonic
1161436551 19:4267132-4267154 GGCACCGCAGAGCCAGCAGTGGG + Intronic
1162886898 19:13703460-13703482 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1163153967 19:15430055-15430077 GGCACCGCAGACCTCGCAGGTGG + Intronic
1163368661 19:16889868-16889890 GCCAGCGCTGGCCACGCAGGTGG - Exonic
1163687327 19:18719270-18719292 GGCCCCGCTAGCCCAGAATGCGG + Intronic
1163783922 19:19264735-19264757 GGCAACGGTAGGCCAGCAGGTGG + Exonic
1163905880 19:20150020-20150042 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1164106021 19:22107700-22107722 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1164106044 19:22107749-22107771 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1164192093 19:22926159-22926181 GGCACGGCTGGCCAGGCAGGGGG - Intergenic
1164652459 19:29899528-29899550 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1165192934 19:34079421-34079443 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1165192980 19:34079520-34079542 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1165193002 19:34079569-34079591 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1165193024 19:34079618-34079640 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1165405708 19:35629560-35629582 GGCACCGCAGGCACAGCAGTTGG - Exonic
1165445742 19:35856134-35856156 TGCGCAGCTGGCCGAGCAGGTGG - Intronic
1165566819 19:36736750-36736772 GGCACCGCGGGACCAGAAGGTGG + Intronic
1166028568 19:40108741-40108763 GGCACAGCTGGCCGGGCGGGGGG + Intergenic
1166234231 19:41444029-41444051 TGCACAGCTGTCCCAGCAGCTGG - Exonic
1166558967 19:43719494-43719516 GGCCAAGCTGGCCGAGCAGGTGG + Exonic
1166717217 19:44976244-44976266 GGCCTGGCAGGCCCAGCAGGGGG + Intronic
1166773829 19:45300459-45300481 GGCAGCTCAGGGCCAGCAGGAGG + Intronic
1167002836 19:46756083-46756105 GGCGCCCCTGGCCCGGCCGGTGG + Exonic
1168693992 19:58394930-58394952 GGCACCCCAGGGCTAGCAGGTGG + Intergenic
925218458 2:2117439-2117461 GGCATCGTTGGATCAGCAGGCGG + Intronic
928558016 2:32447631-32447653 GGCGCGGCTGGCCGGGCAGGGGG + Intronic
928596960 2:32868757-32868779 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
928987070 2:37191979-37192001 GGCATGGCCGGCCCAGCAGCGGG + Intronic
929416059 2:41747047-41747069 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
929614555 2:43297510-43297532 GGCACGGCTGGCCGGGCGGGGGG - Intronic
929614578 2:43297559-43297581 GGCACGGCTGGCCAGGCGGGGGG - Intronic
930668209 2:54120742-54120764 GGCACCCCTGGACCAGCTGCGGG - Intronic
932228171 2:70059906-70059928 GGAACAGGTTGCCCAGCAGGAGG - Intergenic
935130340 2:100256758-100256780 GGAAGCGCAGGCCCAGGAGGTGG - Intergenic
935248974 2:101244954-101244976 GGCATCGCGGGACCAGAAGGCGG + Intronic
936278656 2:111120533-111120555 GCCTCCGCTGGCCCGGCCGGCGG - Intronic
936546157 2:113394411-113394433 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
936546180 2:113394460-113394482 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
937292074 2:120787748-120787770 AGCACCGCTGACCCAGCAGAGGG - Intronic
937919531 2:127119910-127119932 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
938374709 2:130797897-130797919 CGCACCACTGGCCCCGCAGTCGG + Intergenic
939268924 2:139912766-139912788 GGCACCACAGGACCAGAAGGCGG - Intergenic
940015422 2:149099485-149099507 GTCACAGCAGGGCCAGCAGGAGG + Intronic
941814745 2:169786397-169786419 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
942630206 2:177945789-177945811 GGCACGGCTGGCCGGGCGGGGGG - Intronic
942630229 2:177945838-177945860 GGCACGGCTGGCCAGGCGGGGGG - Intronic
943773649 2:191742600-191742622 GGAGCGGCTGGCCCAGCGGGGGG - Intergenic
944743677 2:202635401-202635423 GGCGCCTCAGGCCCCGCAGGCGG + Exonic
945115078 2:206401244-206401266 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
945488891 2:210431040-210431062 GGCACCGCAGAACCAGAAGGCGG + Intergenic
947355392 2:229289456-229289478 AGCACCGCGGGACCAGAAGGTGG + Intergenic
948461286 2:238131087-238131109 GCCACAGGTGGCCCAGCCGGGGG - Exonic
948899805 2:240950560-240950582 GTCACCTCTGGCCCAGCACAAGG + Intronic
1168892633 20:1304959-1304981 GGCCCAGCTGGCCCTGAAGGAGG + Exonic
1170424965 20:16227725-16227747 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1170424988 20:16227774-16227796 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1172059092 20:32176252-32176274 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1172141243 20:32724104-32724126 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1172348577 20:34223508-34223530 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1172348600 20:34223557-34223579 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1173980488 20:47220227-47220249 AGCACCGTTCGCCCACCAGGGGG + Intronic
1175540353 20:59744151-59744173 GGGAGTGCTGGCCTAGCAGGAGG - Intronic
1175905245 20:62376458-62376480 GGCTCCCCAGGCCCCGCAGGAGG + Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176230008 20:64027768-64027790 GGCACAGCTTCCCCATCAGGTGG + Intronic
1176511285 21:7750508-7750530 GGCTCGGCAGGCCCTGCAGGAGG + Intronic
1177178491 21:17720565-17720587 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1177411020 21:20730811-20730833 GGCATAGCTAACCCAGCAGGTGG + Intergenic
1178645399 21:34381037-34381059 GGCTCGGCAGGCCCTGCAGGAGG + Intronic
1178983145 21:37282073-37282095 GGAACCGGCGGCACAGCAGGAGG + Intergenic
1179067487 21:38039562-38039584 GGCAGGTCTGTCCCAGCAGGGGG + Intronic
1179502185 21:41816729-41816751 TGCGCGGCTGGGCCAGCAGGGGG + Intronic
1179569432 21:42269370-42269392 GGCACCCATGGCTCAGCAGAAGG + Intronic
1179800285 21:43808520-43808542 GGAACCGGGGGCCCTGCAGGAGG - Intergenic
1180005208 21:45017615-45017637 GGGACCTCTGGCCCACCATGGGG + Intergenic
1180098749 21:45574512-45574534 GTCACCCCTGGCCCCACAGGAGG + Intergenic
1180855388 22:19041840-19041862 GGCGCCGCTGGCGCAGCCGGTGG + Exonic
1180975444 22:19845440-19845462 GGCAGCGCAGGCACAGCAGGGGG + Intronic
1181163124 22:20969145-20969167 GGCACCGCTGGGCTGGCAGGAGG + Intronic
1181786583 22:25231585-25231607 ATCACCTCTGGCCCTGCAGGTGG + Exonic
1181982191 22:26773408-26773430 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1182089283 22:27583272-27583294 GACACCACTGGCTCAGCAGATGG - Intergenic
1182616784 22:31593060-31593082 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1182664085 22:31944763-31944785 GGCGCGGCTGGCCGAGCAGGCGG + Exonic
1183364633 22:37400401-37400423 GGCAGCCCTGGCCCTCCAGGTGG - Intronic
1183409828 22:37648337-37648359 GGCACGGCTGGCCGAGGAGCAGG + Exonic
1185070527 22:48653385-48653407 GCCACTTCAGGCCCAGCAGGTGG + Intronic
950253684 3:11487666-11487688 GGCACGGCTGGCCAGGCGGGGGG + Intronic
950643540 3:14363665-14363687 GGCACAGCTGGAGAAGCAGGTGG + Intergenic
950649825 3:14400487-14400509 GGCTCCGCTGGCCTACCTGGAGG + Intergenic
951013466 3:17705077-17705099 GGCACGGCTGGCCAGGCGGGGGG + Intronic
951013511 3:17705174-17705196 GGCACGGCTGGCCAGGCGGGGGG + Intronic
951013533 3:17705223-17705245 GGCACGGCTGGCCAGGCGGGGGG + Intronic
951013555 3:17705272-17705294 GGCACGGCTGGCCAGGCGGGGGG + Intronic
951294875 3:20921552-20921574 GGCACCGCGGGACCAGAAGGCGG - Intergenic
952776756 3:37053850-37053872 AGCACTTCTGGCCCAGCAGTAGG - Exonic
952877407 3:37957827-37957849 GGCTCTGCTGGCAGAGCAGGAGG - Intronic
952896499 3:38081820-38081842 GGCACGGCTGGCCAGGCGGGGGG + Intronic
953426071 3:42797918-42797940 GGCACGGCTGGCCGGGCGGGGGG - Intronic
953874817 3:46660707-46660729 GGCACCGCTGCCCCAGCTCCAGG + Intergenic
954059386 3:48056224-48056246 GGCACGGCTGGCCAGGCGGGGGG - Intronic
954080704 3:48211499-48211521 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
954080727 3:48211548-48211570 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
955297424 3:57747642-57747664 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
956270436 3:67444120-67444142 GGCACGGCTGGCCAGGCGGGGGG - Intronic
958808856 3:98838072-98838094 GGCACGGCTGGCCAGGCCGGGGG + Intronic
959042668 3:101439460-101439482 GGCACGGCTGGCCAGGCGGGGGG - Intronic
959042690 3:101439509-101439531 GGCACGGCTGGCCAGGCGGGGGG - Intronic
959221909 3:103531518-103531540 GGGGCGGCTGGCCGAGCAGGGGG + Intergenic
959419414 3:106112003-106112025 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
960526646 3:118718456-118718478 GGGGCCGCTGGCCGGGCAGGGGG + Intergenic
961662876 3:128479706-128479728 GGGGCCCCTGGCCCAGGAGGAGG - Exonic
961729273 3:128954575-128954597 GGCACGGCTGGCCGGGCGGGGGG - Intronic
962677728 3:137768957-137768979 GGCGCCCGTGGCCCTGCAGGAGG + Intergenic
963166315 3:142207698-142207720 GGCACCGCAGGACCAGAAGGCGG + Intronic
964004035 3:151808743-151808765 GGCACTGCAGGACCAGAAGGCGG - Intergenic
965192419 3:165548750-165548772 GGCATCGCAGGACCAGAAGGCGG + Intergenic
966359631 3:179120128-179120150 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
966359653 3:179120177-179120199 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
966359974 3:179120902-179120924 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
966863813 3:184245220-184245242 CCCAGCGCTGGGCCAGCAGGAGG + Exonic
968461035 4:725082-725104 GACACCGCGGGTGCAGCAGGCGG + Intronic
968632010 4:1656653-1656675 CGCACCACAGGCCCGGCAGGGGG + Intronic
968863761 4:3194441-3194463 GGCACCAGAGGCCCAGGAGGTGG + Intronic
968879557 4:3292289-3292311 GGCACCGCTGGCACGAGAGGAGG - Intergenic
969052009 4:4379909-4379931 GCCATCCCTGGGCCAGCAGGAGG + Intronic
969587854 4:8104749-8104771 GGTGCCGCTGGCCCTGGAGGAGG - Intronic
969612754 4:8236349-8236371 GGCACTGCTGGCCACGCTGGAGG + Exonic
973281446 4:48363901-48363923 GGCACGGCTGGCCAGGCGGGGGG + Intronic
973593481 4:52465073-52465095 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
973593501 4:52465115-52465137 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
973964682 4:56149242-56149264 GGCAGCACTGGCCTAGCAGGAGG - Intergenic
975619509 4:76281886-76281908 GGCACCGTGGGACCAGAAGGCGG - Intronic
975936868 4:79592042-79592064 GGCACCGCAGGACCAGAAGGCGG - Intergenic
976636445 4:87291133-87291155 GGCACCGCGGGACCAGAAGGCGG - Intergenic
978544777 4:109859193-109859215 GGCACCGTGGGACCAGAAGGTGG - Intronic
981970488 4:150659686-150659708 GGCACGGCTGGCCGGGCGGGGGG - Intronic
982615907 4:157637109-157637131 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
985446511 4:190023722-190023744 GGTCCCGCTGGCCCTGGAGGCGG + Intergenic
985520857 5:373459-373481 GGCACAGCTGGGCCAGCAGGAGG - Intronic
986179063 5:5376456-5376478 CCCAGCGCTGGACCAGCAGGAGG + Intergenic
986294791 5:6429048-6429070 GGAACCGGTTGCACAGCAGGAGG + Intergenic
988112083 5:26834862-26834884 GCCACAGCTGACCCAACAGGAGG - Intergenic
988552048 5:32208210-32208232 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
988760609 5:34306735-34306757 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
988769850 5:34421487-34421509 GGCACCGTGGGACCAGAAGGTGG - Intergenic
991079693 5:62584901-62584923 GGCACATCTGGGCCAGCAGCAGG - Intronic
992373885 5:76171672-76171694 GGCACGGCTGGCCGGGCGGGGGG - Intronic
992373908 5:76171721-76171743 GGCACGGCTGGCCAGGCGGGGGG - Intronic
992470026 5:77043561-77043583 GGCACGGCTGGCCAGGCGGGGGG + Intronic
992470050 5:77043605-77043627 GGCACGGCTGGCCGGGCGGGGGG + Intronic
992818692 5:80471578-80471600 GGCACCACGGGACCAGAAGGCGG + Intronic
993362898 5:87000236-87000258 GGTACTGCTGTCCCAGAAGGTGG + Intergenic
998432134 5:142076368-142076390 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
999286914 5:150399606-150399628 CTCACCACTGGCCCAGGAGGCGG - Intronic
999682498 5:154073116-154073138 GGCACCGCGGGACCAAAAGGCGG - Intronic
1002013700 5:176305152-176305174 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1002115825 5:176961601-176961623 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1002635282 5:180604408-180604430 GACACAGCTGGCTCCGCAGGAGG - Intronic
1002681814 5:180970589-180970611 CACACCGCTGGCCCAGCCTGGGG - Intergenic
1003427260 6:6006149-6006171 GGCACCGCAGACCCGGCTGGTGG - Intronic
1005972802 6:30774692-30774714 GGTCACTCTGGCCCAGCAGGAGG - Intergenic
1006377534 6:33679926-33679948 GGCATCGCTGGCCCACCTGCTGG + Exonic
1006492309 6:34397630-34397652 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1007006847 6:38372106-38372128 GGCACTGATGGCCCAGGAGATGG - Intronic
1007414797 6:41684994-41685016 GGCTGAGCTGGCCCAGCAGGTGG - Exonic
1007674251 6:43580918-43580940 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1008272647 6:49507807-49507829 GGCACTGCAGGACCAGAAGGTGG - Intronic
1008553521 6:52655587-52655609 GGGACGGCTGGCCGGGCAGGGGG + Intergenic
1010277964 6:73990919-73990941 GGCTCTGCTGGCCCAGCACTGGG - Intergenic
1010440881 6:75892541-75892563 GGCACAGCTGGCCCGACAGAAGG + Exonic
1011087634 6:83560186-83560208 GGCATGCCTGTCCCAGCAGGAGG + Exonic
1012733421 6:102910118-102910140 GGCACCGCGAACCCACCAGGAGG - Intergenic
1014265258 6:119269618-119269640 GGTACTGCTGGGCCAGAAGGTGG - Intronic
1017244361 6:152206618-152206640 GGGACATCTGACCCAGCAGGGGG + Intronic
1017782594 6:157727847-157727869 GCCACAGCTGGCCCAGAAGCGGG + Intronic
1017843981 6:158240773-158240795 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1018763968 6:166915253-166915275 GGCACTGCAGGACCAGAAGGCGG - Intronic
1018950776 6:168377497-168377519 GGCACCCCTGGCCTTGGAGGTGG + Intergenic
1019100649 6:169626471-169626493 GGGACAGCTGCACCAGCAGGAGG - Intronic
1019274299 7:167657-167679 GGCTGCGGTGGCCCAGCGGGAGG + Intergenic
1019445808 7:1070317-1070339 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1019525681 7:1479438-1479460 GGCAGAGCTGGCGCAGCAGCGGG + Exonic
1019541901 7:1555387-1555409 GGCCCAGCTGGCACAGCCGGTGG + Exonic
1019612039 7:1941527-1941549 TGCACTGCTGGCCCCGCTGGGGG + Intronic
1019669167 7:2268511-2268533 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1019693133 7:2428511-2428533 GGCATCGCAGGACCAGAAGGCGG - Intronic
1020616456 7:10465859-10465881 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1020616479 7:10465908-10465930 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1021813497 7:24425882-24425904 GGCACGCCTGGCCCAGCTGTGGG - Intergenic
1021872326 7:25018615-25018637 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1021880775 7:25093509-25093531 GTCACACTTGGCCCAGCAGGGGG - Intergenic
1022005443 7:26262185-26262207 GGGGCGGCTGGCCCGGCAGGGGG - Intergenic
1024247314 7:47480066-47480088 GGCGCCGCTGGCCGAGCCTGGGG + Intronic
1024989136 7:55220215-55220237 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1025735608 7:64144068-64144090 GGCACTGCAGGACCAGAAGGCGG - Intronic
1026783360 7:73284299-73284321 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1026783383 7:73284348-73284370 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1027244612 7:76358757-76358779 AGCCCGGCTGGCCGAGCAGGCGG - Exonic
1027371149 7:77509389-77509411 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1027778941 7:82499684-82499706 GGCTCCGCTGGCCCTGCACTGGG + Intergenic
1027795728 7:82691210-82691232 GGCACACCTGGCCCAGCTGCGGG - Intergenic
1028707736 7:93869987-93870009 GGCACCGTGGGACCAGAAGGCGG - Intronic
1029241624 7:99167255-99167277 GGCAAGGCTGGCCCTGAAGGAGG - Intergenic
1029468903 7:100741892-100741914 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1029524809 7:101088104-101088126 GGCCCTGCTGGCCCAGAAGCAGG + Exonic
1030319304 7:108147129-108147151 GGCAGCTCTGAGCCAGCAGGAGG + Intergenic
1032074502 7:128830182-128830204 GGCACCGGGGGCCCAGGGGGTGG + Intergenic
1032116309 7:129120707-129120729 GGCACTGCTGGCCCAGAGGAAGG + Intergenic
1034268025 7:149790549-149790571 GGCCCCCCTGGCCAAGCCGGCGG + Intergenic
1034322552 7:150198766-150198788 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1034335976 7:150323632-150323654 GGCACCGCTGGCCCAGCAGGTGG - Intronic
1034436467 7:151064910-151064932 TGCACCACTGCCCCACCAGGAGG + Exonic
1035507904 8:149905-149927 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1035507927 8:149954-149976 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1036290685 8:7486938-7486960 GGCACTGTTGGCGCAGCAAGGGG + Intergenic
1036711965 8:11085572-11085594 GGCACTGCTGGACGAGGAGGGGG + Intronic
1037005000 8:13767438-13767460 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1038094611 8:24293958-24293980 TGCAACAATGGCCCAGCAGGCGG - Intergenic
1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG + Intergenic
1039672551 8:39618262-39618284 GGCACCACAGGACCAGAAGGCGG - Intronic
1039905466 8:41783044-41783066 AGCTCCGCAGGCCCAGGAGGAGG + Intronic
1040386422 8:46917818-46917840 GGCGCTGCGGGGCCAGCAGGGGG + Intergenic
1041646562 8:60258817-60258839 GCCACCGCTGATCCAACAGGAGG + Intronic
1041796593 8:61753106-61753128 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1041796616 8:61753155-61753177 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1042048974 8:64685788-64685810 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1042049018 8:64685886-64685908 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1044660648 8:94590866-94590888 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1044660671 8:94590915-94590937 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1044988648 8:97776261-97776283 GTCGGCGCTGGCCCAGCCGGGGG - Intronic
1045504551 8:102769265-102769287 GACACGGCAGTCCCAGCAGGAGG - Intergenic
1047251053 8:123182434-123182456 GGCACCACCAGCCCAGCTGGAGG - Exonic
1047687267 8:127316442-127316464 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1047687311 8:127316540-127316562 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1047848077 8:128826482-128826504 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1047848100 8:128826531-128826553 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1048422267 8:134288865-134288887 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1049397099 8:142405974-142405996 GTCACAGCTGGCCCAGCTGCTGG - Intergenic
1049616027 8:143576074-143576096 GGCCCGACTGGCCCAGGAGGTGG - Exonic
1049658349 8:143808743-143808765 GGCTCCTCGGGCCCAGAAGGAGG - Exonic
1049675316 8:143886515-143886537 GGCACCTCTGGGCCTGGAGGTGG - Intergenic
1049738635 8:144223301-144223323 GGAGCCACTGGCCCAGCAGAGGG + Intronic
1049741110 8:144241439-144241461 GGACACGCTGGCCCAGCTGGAGG + Exonic
1049782442 8:144435130-144435152 GGCCTGGCTGGCCGAGCAGGCGG - Exonic
1052866060 9:33465304-33465326 GGCACGGCTGGCCAAGCGGTGGG - Exonic
1053255780 9:36615224-36615246 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1053255801 9:36615273-36615295 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1053255848 9:36615371-36615393 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1053255870 9:36615420-36615442 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1055137510 9:72841486-72841508 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1055414266 9:76064386-76064408 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1055414289 9:76064435-76064457 GGCACGGCTGGCCGGGCGGGGGG + Intronic
1055948330 9:81710474-81710496 GGCACAGCTGGCCGGGCGGGGGG - Intergenic
1056881375 9:90396909-90396931 GGCACCCCTACCCCAGCAGTGGG + Intergenic
1056984674 9:91351616-91351638 GGAACCGGTGACACAGCAGGAGG + Intronic
1057864360 9:98667403-98667425 GGCACCGCTACCCCAGCTGCAGG + Intronic
1057910448 9:99016060-99016082 GGCAGCGGTGGCCCATCAGGGGG - Exonic
1058659889 9:107257532-107257554 GGCACGGCTGGCCGGGCGGGGGG + Intergenic
1058722580 9:107776326-107776348 GGCACGGCTGGCCGGGCGGGGGG - Intergenic
1059120847 9:111640896-111640918 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1059120875 9:111640962-111640984 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1059211044 9:112514362-112514384 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1059211067 9:112514411-112514433 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1059311282 9:113390546-113390568 GGCACCTCTGGGTCAGGAGGTGG - Intronic
1060064963 9:120495715-120495737 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1060064986 9:120495764-120495786 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1060345195 9:122809799-122809821 GGCACCACGGGACCAGAAGGCGG + Intronic
1060435235 9:123587073-123587095 GGCACCGCAGGACCAGAAGCTGG - Intronic
1060503291 9:124179415-124179437 GCCACCGCTGACCTAACAGGAGG - Intergenic
1060687115 9:125623768-125623790 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1060734761 9:126059829-126059851 GCCACCGCCTGCCCAGCAGAGGG + Intergenic
1060849304 9:126861005-126861027 GGCGCCGCTGGCCCGGCTGAGGG + Intronic
1061983910 9:134118405-134118427 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1062365102 9:136204675-136204697 GGCATCGCAGGCACAGCTGGGGG - Intronic
1062383166 9:136297489-136297511 GCCACCACTGGAGCAGCAGGTGG - Intronic
1062420016 9:136476123-136476145 GGCACAGCTGGCCCAGGAAGGGG + Exonic
1062741177 9:138176085-138176107 AGCACCGTTCGCCCTGCAGGTGG - Intergenic
1185627733 X:1494189-1494211 GCCGCCTCTGGCCCAGGAGGAGG - Intronic
1187976448 X:24709269-24709291 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1187976515 X:24709416-24709438 GGCACGGCTGGCCAGGCGGGGGG + Intronic
1188477153 X:30602462-30602484 GGCACGGCTGGCCAGGCGGGGGG - Intergenic
1189017282 X:37297320-37297342 GGCACCGCAGGACCAGAAGGCGG - Intergenic
1191618121 X:63189673-63189695 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1191618143 X:63189722-63189744 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1192621252 X:72681457-72681479 GGCACGGCTGGCCGGGCGGGGGG - Intronic
1192621275 X:72681506-72681528 GGCACGGCTGGCCAGGCGGGGGG - Intronic
1193565497 X:83071155-83071177 GGCACCACGGGACCAGAAGGCGG + Intergenic
1194192508 X:90855215-90855237 GGCACCACGGGACCAGAAGGTGG + Intergenic
1194890501 X:99372326-99372348 GGCTCGGCTGGCCCAGCACTCGG - Intergenic
1196404367 X:115347468-115347490 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1196404388 X:115347517-115347539 GGCACGGCTGGCCAGGCGGGGGG + Intergenic
1196404434 X:115347615-115347637 GGCACGGCTGGCCAGGCAGGGGG + Intergenic
1196872317 X:120124806-120124828 GCCACCGCTGATCCAACAGGAGG + Intergenic
1198267689 X:135024578-135024600 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1200126727 X:153818842-153818864 GGCACCGCTTTCCCCGCATGAGG + Intronic
1200539140 Y:4437659-4437681 GGCACCACGGGACCAGAAGGTGG + Intergenic
1200835183 Y:7725685-7725707 GGCACCTCTGGGCCAGCACGAGG + Intergenic