ID: 1034341952

View in Genome Browser
Species Human (GRCh38)
Location 7:150363092-150363114
Sequence GGGGAGGCCCCGAAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034341952_1034341959 8 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341959 7:150363123-150363145 TCTCTTGGTGCTCTCCAGCTGGG No data
1034341952_1034341964 25 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341964 7:150363140-150363162 GCTGGGAAGGCTCAAAGGATGGG No data
1034341952_1034341954 -7 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341954 7:150363108-150363130 CCTCCCCAACTGCGTTCTCTTGG No data
1034341952_1034341960 12 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341960 7:150363127-150363149 TTGGTGCTCTCCAGCTGGGAAGG No data
1034341952_1034341958 7 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341958 7:150363122-150363144 TTCTCTTGGTGCTCTCCAGCTGG No data
1034341952_1034341961 20 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341961 7:150363135-150363157 CTCCAGCTGGGAAGGCTCAAAGG No data
1034341952_1034341963 24 Left 1034341952 7:150363092-150363114 CCTTCATCTTTCGGGGCCTCCCC No data
Right 1034341963 7:150363139-150363161 AGCTGGGAAGGCTCAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034341952 Original CRISPR GGGGAGGCCCCGAAAGATGA AGG (reversed) Intergenic
No off target data available for this crispr