ID: 1034342010

View in Genome Browser
Species Human (GRCh38)
Location 7:150363532-150363554
Sequence TGCCTGACTCATGATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034342005_1034342010 14 Left 1034342005 7:150363495-150363517 CCCTCTCACATTGTGGGAAAACT No data
Right 1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG No data
1034342006_1034342010 13 Left 1034342006 7:150363496-150363518 CCTCTCACATTGTGGGAAAACTG No data
Right 1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034342010 Original CRISPR TGCCTGACTCATGATGAGGC CGG Intergenic
No off target data available for this crispr