ID: 1034343052

View in Genome Browser
Species Human (GRCh38)
Location 7:150370112-150370134
Sequence CCTCCTCCGCGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034343052_1034343067 30 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343067 7:150370165-150370187 CTGTGGAAGAGCTGAACATGGGG 0: 1
1: 0
2: 1
3: 20
4: 212
1034343052_1034343066 29 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343066 7:150370164-150370186 GCTGTGGAAGAGCTGAACATGGG 0: 1
1: 1
2: 0
3: 14
4: 189
1034343052_1034343065 28 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343065 7:150370163-150370185 AGCTGTGGAAGAGCTGAACATGG 0: 1
1: 0
2: 0
3: 22
4: 276
1034343052_1034343059 -3 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343059 7:150370132-150370154 AGGCTCCTGTGCAGGAATCTGGG 0: 1
1: 0
2: 1
3: 19
4: 231
1034343052_1034343058 -4 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343058 7:150370131-150370153 GAGGCTCCTGTGCAGGAATCTGG 0: 1
1: 0
2: 0
3: 22
4: 189
1034343052_1034343061 13 Left 1034343052 7:150370112-150370134 CCTTCCTCCTTCCGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1034343061 7:150370148-150370170 ATCTGGGCTCCCCTGAGCTGTGG 0: 1
1: 2
2: 3
3: 45
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034343052 Original CRISPR CCTCCTCCGCGGAAGGAGGA AGG (reversed) Intronic
900207797 1:1439019-1439041 CCTCCTCCGCTGCTGGAGGGCGG - Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901217939 1:7565213-7565235 GCTTCTCCGGGGAATGAGGAGGG - Intronic
903935669 1:26893183-26893205 CCTCCTCCAAGAAAGGATGAAGG + Intronic
904013903 1:27406020-27406042 CCTTTTCCGGGCAAGGAGGATGG + Exonic
905202484 1:36323628-36323650 TTTCCTCCGAGGAAAGAGGAGGG + Intronic
905533150 1:38698140-38698162 TCTCCTCCCAGGAAGGAGCATGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906521473 1:46469467-46469489 CCCCCTCCCCCAAAGGAGGATGG + Intergenic
908131476 1:61080012-61080034 CCTCCCCCGCGGAGGGAGGGGGG - Intronic
910111869 1:83692136-83692158 CTTCCTCCGGTGAAGGAGAATGG - Intergenic
915093596 1:153443767-153443789 CCTCTCCAGGGGAAGGAGGATGG + Intergenic
916010612 1:160702284-160702306 CCTCCTCCACAGTAGGAGGCGGG - Intronic
918215451 1:182389710-182389732 CCTGGTCCACGGAGGGAGGAGGG - Intronic
920039913 1:203088842-203088864 CCTCTTCAGAGGCAGGAGGATGG + Intergenic
921355392 1:214280874-214280896 CCTCCTCCTCGGTGGGAGGGAGG - Intergenic
922596311 1:226816119-226816141 GCTCCTCAGAGGAAGGAAGATGG - Intergenic
922824807 1:228510418-228510440 CCTCCTCCCTGAAAGGAGGAAGG - Intergenic
1065390123 10:25174752-25174774 CCTCCCCCGAGGAGGGAGCAGGG + Intergenic
1066180710 10:32958274-32958296 CCTCCTCAGGGGCGGGAGGAGGG + Intronic
1067479813 10:46587413-46587435 CTTCCTCCTGGGGAGGAGGAGGG + Intronic
1067614924 10:47754384-47754406 CTTCCTCCTGGGGAGGAGGAGGG - Intergenic
1069864788 10:71495313-71495335 CCTCCTTCGCGGCAGGAGGGTGG + Intronic
1069872220 10:71540154-71540176 CTTCCTCCGGGGTAGGGGGATGG + Intronic
1069981379 10:72255204-72255226 CAGCCTCCGCGGGAGGAGGTCGG - Intergenic
1071630329 10:87214348-87214370 CTTCCTCCTGGGGAGGAGGAGGG - Intergenic
1072190698 10:93074294-93074316 CTTCCTCCGCTGTGGGAGGAAGG - Exonic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1075071026 10:119319975-119319997 CCTGCTCCCGGGAAGGAGGCGGG - Intronic
1077011448 11:380998-381020 CCTCCTCCTCTGAATGGGGAAGG + Intronic
1077066681 11:644156-644178 CCACCTGCGCAGTAGGAGGAAGG + Intergenic
1077076815 11:705894-705916 CCGCCTCCGCGGGATGAGCAGGG - Intronic
1077497089 11:2891616-2891638 CCTCCTCCACTGCAGGAGGAGGG + Intronic
1079283513 11:19108865-19108887 CAACCTCGGAGGAAGGAGGAAGG - Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1083830030 11:65225642-65225664 TCTCCCTCGCGGAAAGAGGAAGG - Intergenic
1084337907 11:68471845-68471867 GCTCCTCCCTGGTAGGAGGAGGG + Intronic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1089278225 11:117354129-117354151 CCTGCTCCTCGGAAGGCTGAGGG - Intronic
1089357402 11:117862780-117862802 CCTCCTCAACCCAAGGAGGAGGG - Intronic
1090273295 11:125402792-125402814 CCCCCTCTGAGGAAGGATGAAGG - Intronic
1091344450 11:134843528-134843550 CATCCTCCCAGGAGGGAGGATGG + Intergenic
1091665176 12:2413750-2413772 CCTTCTCCGTGGAAGGACCATGG - Intronic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092528706 12:9326773-9326795 CCTCCTCAGCGGGAGGAGGGGGG + Intergenic
1093547680 12:20368242-20368264 CCTCCTCCGCAGGAGGGGGCGGG + Intergenic
1093662630 12:21774800-21774822 CCACTTCAGTGGAAGGAGGAGGG + Exonic
1096182344 12:49557752-49557774 CCCCTTCCTCAGAAGGAGGAGGG - Exonic
1096496656 12:52042862-52042884 CCTCTTCCAGGGAAGGAGGAAGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1108485200 13:50916850-50916872 CATCCTCCCAGGAAGGAGCAGGG + Intronic
1112004584 13:95243461-95243483 TCTCCTCCTCGGATGGACGAGGG - Intronic
1114654591 14:24308488-24308510 CCTCCTCCGACCAAGGAGGAAGG - Exonic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1119566895 14:75636472-75636494 CTTGCTCTGCGGCAGGAGGAGGG + Intronic
1121219038 14:92272048-92272070 CCTCTTCCTCTGGAGGAGGAAGG - Intergenic
1121584326 14:95052415-95052437 CCTCCTCGTCGGAAGCAGGCTGG + Intergenic
1122075906 14:99234369-99234391 CCTCCTCTGAGGAAGGATGGGGG - Intronic
1124291385 15:28456209-28456231 CCTCCTGCGAGGCAGGAGCATGG + Intergenic
1130660747 15:85829905-85829927 CCACCACTGAGGAAGGAGGAAGG + Intergenic
1130849257 15:87777824-87777846 GCGCCTCGGGGGAAGGAGGAAGG + Intergenic
1132154712 15:99487199-99487221 CCTCCTCCGGTGACAGAGGAGGG + Intergenic
1133212909 16:4273065-4273087 CTTACTCCGCGGAAGGAGGCCGG - Exonic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1135184186 16:20300614-20300636 ACACGTCCGCGGAAGGAGGGAGG - Intergenic
1135659872 16:24286916-24286938 CCTCCTGCTGTGAAGGAGGAAGG + Intronic
1139378083 16:66513386-66513408 TGTCATCCACGGAAGGAGGAAGG + Intronic
1203062672 16_KI270728v1_random:988270-988292 CCTCCTGCGAGGCAGGAGCATGG + Intergenic
1142747493 17:1967144-1967166 GCTCCTCCCCAGAAGGAAGAGGG + Intronic
1143780795 17:9228273-9228295 GCTCCTCGGTGGAGGGAGGAAGG + Intronic
1143962168 17:10729925-10729947 GTCCCTCCGCGCAAGGAGGAAGG - Exonic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1148909149 17:50931219-50931241 CCTCCTGCCCGGACGGCGGAGGG - Intergenic
1151718319 17:75842699-75842721 CCTCCTCCGGGGGAGAGGGAAGG + Intronic
1151996242 17:77611098-77611120 CCTTCTCGGTGGAGGGAGGATGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1158137539 18:54224076-54224098 CCTCCCCCCCGGATGGAAGAAGG - Exonic
1159035616 18:63274704-63274726 GGTCCTCCGCGGCAGGTGGAAGG - Intronic
1160024982 18:75209391-75209413 CCTCTCCCGCGCCAGGAGGAAGG - Intergenic
1160672715 19:373837-373859 CCTCCTCCCTGGAGAGAGGAGGG + Intronic
1162145229 19:8609286-8609308 CCTCCTCCCCGAAGGCAGGAGGG + Intronic
1162326670 19:10003665-10003687 CGTCCTCGGCGGAAGGGGAAGGG - Exonic
1163598069 19:18231955-18231977 CCTGCTCCCCTGTAGGAGGAAGG - Intronic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166219118 19:41353864-41353886 GCTGCTCCGCGGAGGGAGGTGGG + Exonic
1167134483 19:47608812-47608834 CCTCCTCCGGCGAGGGCGGAGGG + Intronic
927259389 2:21071514-21071536 CGTCCTCCAAGGAAGGAGGGTGG - Intergenic
927971435 2:27308071-27308093 GCTCCTCCGGGGAGGGAGGCTGG - Intronic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
928999596 2:37332985-37333007 CCTACTCCGCTGAAGGAAGCGGG + Intergenic
930073830 2:47390763-47390785 CATCCTCCAAGGTAGGAGGATGG - Intergenic
932493080 2:72133750-72133772 CCTCCTCCTGCGATGGAGGAAGG - Intronic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
938377947 2:130820724-130820746 CCTCCTCTGCGGCACGGGGAAGG + Intergenic
946340459 2:219063578-219063600 CTTCCTCCACTGAAGGAGGTTGG - Intergenic
947324681 2:228961475-228961497 CCTCCCCTGGGGAAGGAGCAAGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175922850 20:62458199-62458221 CCTCCTCCACAGCAGCAGGAGGG - Intergenic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1184430945 22:44441324-44441346 CCTCCTCAAGGGCAGGAGGAAGG + Intergenic
1184478800 22:44735688-44735710 CCTCCCCCGCGGGAGGGGAAGGG - Intronic
1184730789 22:46369909-46369931 CCTTCTCAGAGGAAGGAGCAAGG + Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
1185279139 22:49962478-49962500 CCTCCCCCGCGGCCGGCGGAGGG + Intronic
952040108 3:29251344-29251366 CCTCCTCAGCTGAAGATGGAGGG - Intergenic
953534841 3:43769741-43769763 CCTCCTCCAAGGAAGGCGGAAGG - Intergenic
960040845 3:113148561-113148583 CATGCTCCCAGGAAGGAGGAAGG + Intergenic
965835209 3:172843383-172843405 CCTCCTCAGTGGATGAAGGAGGG + Intergenic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
968076476 3:195818365-195818387 CCTCCTCCACGGTAGAATGAGGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
976521577 4:86033949-86033971 TCTCCTTAGCGGAAGGAGGCAGG - Intronic
976734168 4:88294124-88294146 CTTCCTCCCTGGAAGGAAGATGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
980823721 4:138048808-138048830 CTTCCTCCGAGAAAGGAGGTGGG - Intergenic
982288649 4:153759430-153759452 CTTCCGCCGAGGAGGGAGGAGGG + Intronic
983296435 4:165873886-165873908 TTTCCTCCGGGGGAGGAGGATGG + Exonic
984470839 4:180171245-180171267 CCTCTTCCGTGGATGGATGATGG - Intergenic
984721310 4:182975626-182975648 CATCCACCGCGGAAGGTGGGGGG - Intergenic
984758558 4:183344980-183345002 CCTCCTCCTTGGAAGCAGGATGG - Intergenic
985784543 5:1886992-1887014 CCGCCTCCTCGGAAGGGGGGAGG + Exonic
987183018 5:15386252-15386274 CCAGCTCTGGGGAAGGAGGAGGG - Intergenic
988829934 5:34977520-34977542 CATCCTCCAGGGAGGGAGGAGGG - Intergenic
991459156 5:66838629-66838651 CCTGCTCTGCGGAAGGAAGCCGG + Intronic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
992845857 5:80746602-80746624 CATCATCCTCGGGAGGAGGACGG + Intronic
998781886 5:145666345-145666367 CCTCCATCGCTGAAGCAGGAAGG + Intronic
1002279533 5:178122336-178122358 CTTCCTCCAGGGAAGGAGGCTGG + Exonic
1002789127 6:424842-424864 CCTCCTCCTGGGACAGAGGAAGG + Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1006682191 6:35805320-35805342 CGCCCTCCGCGGACGGAGGAGGG + Exonic
1017581910 6:155874380-155874402 CCTGCTACCCGGAAGGAGGCTGG + Intergenic
1017604714 6:156121760-156121782 CCTCTTCCCAGCAAGGAGGAAGG + Intergenic
1018633706 6:165842568-165842590 CCTCCTCCTCGAAGGGAGTATGG + Intronic
1018652785 6:166005777-166005799 CTCCCTCCGAGGAAGGAGGTAGG - Intergenic
1019304264 7:325420-325442 CCTCCATCGTGGAAGGAGAAGGG - Intergenic
1019611737 7:1940185-1940207 GCTTCTCCTGGGAAGGAGGAGGG + Intronic
1025051340 7:55737125-55737147 CCTCCTCCATGGTAGGAGGTGGG - Intergenic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026403877 7:70044148-70044170 CCTCTCCAGCGGCAGGAGGAGGG - Intronic
1033657325 7:143382391-143382413 CCGCCTCCTCCGGAGGAGGAGGG + Exonic
1033657327 7:143382394-143382416 CCTCCTCCGGAGGAGGAGGGAGG + Exonic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034900680 7:154906296-154906318 CCTCCTGGGTGGGAGGAGGAAGG + Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036784561 8:11677335-11677357 CCACCTCAGTGGAAGAAGGAGGG - Intronic
1038516050 8:28188468-28188490 CCTCCTCCGGGGAGGGAAGGGGG + Intronic
1041274397 8:56142422-56142444 GCTCCTGGGCGGAAGGAGGCAGG + Intergenic
1044801985 8:95966655-95966677 CAGCATCCGAGGAAGGAGGAAGG - Intergenic
1052282650 9:26750731-26750753 CTTCCTCCTAGGAAGGAGGTTGG + Intergenic
1052652405 9:31321428-31321450 GCTCCTGGGCGGAAGGAGGTGGG - Intergenic
1052995980 9:34551858-34551880 CCACCTCCCCTGAGGGAGGAAGG + Exonic
1057483029 9:95460737-95460759 CCTCCTCCCGGGAGGGAGAAAGG - Intronic
1057604663 9:96490317-96490339 ACTCCTCCGCGGAAGCATGGAGG + Exonic
1060431128 9:123552245-123552267 CCTCCTCAGAGGGAGGAGGTGGG + Intronic
1061056611 9:128226017-128226039 CCTCCTCCCCGGGTGCAGGACGG + Intronic
1061511908 9:131066854-131066876 GCTGCTCCGGGGAAGGTGGAGGG + Intronic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062213979 9:135379102-135379124 CCTCCTCGGGGGAAGGCAGAGGG + Intergenic
1185451232 X:281373-281395 CCTGCTGCCCGGAAGGAGGGAGG - Exonic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187609002 X:20920015-20920037 CCTCCTCCCCGGACAGAGGCTGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic