ID: 1034344778

View in Genome Browser
Species Human (GRCh38)
Location 7:150379477-150379499
Sequence GAGGCAGCACGGGAGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 433}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034344778_1034344802 12 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344802 7:150379512-150379534 GCTGGGGCGGAGGGATGGGGCGG 0: 1
1: 0
2: 12
3: 178
4: 1690
1034344778_1034344805 15 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344805 7:150379515-150379537 GGGGCGGAGGGATGGGGCGGGGG 0: 2
1: 1
2: 19
3: 235
4: 2355
1034344778_1034344794 2 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344794 7:150379502-150379524 CCCGGCCCGGGCTGGGGCGGAGG 0: 1
1: 0
2: 14
3: 141
4: 1006
1034344778_1034344806 20 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344806 7:150379520-150379542 GGAGGGATGGGGCGGGGGCCTGG 0: 1
1: 1
2: 15
3: 251
4: 2078
1034344778_1034344792 -1 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344792 7:150379499-150379521 CCGCCCGGCCCGGGCTGGGGCGG 0: 1
1: 0
2: 1
3: 54
4: 524
1034344778_1034344804 14 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344804 7:150379514-150379536 TGGGGCGGAGGGATGGGGCGGGG 0: 1
1: 0
2: 7
3: 185
4: 2057
1034344778_1034344786 -10 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344786 7:150379490-150379512 GTGCTGCCTCCGCCCGGCCCGGG 0: 1
1: 0
2: 2
3: 28
4: 361
1034344778_1034344807 21 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344807 7:150379521-150379543 GAGGGATGGGGCGGGGGCCTGGG 0: 1
1: 0
2: 7
3: 114
4: 1091
1034344778_1034344808 22 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344808 7:150379522-150379544 AGGGATGGGGCGGGGGCCTGGGG 0: 1
1: 0
2: 6
3: 131
4: 1193
1034344778_1034344803 13 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344803 7:150379513-150379535 CTGGGGCGGAGGGATGGGGCGGG 0: 1
1: 0
2: 12
3: 174
4: 1919
1034344778_1034344788 -5 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344788 7:150379495-150379517 GCCTCCGCCCGGCCCGGGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 382
1034344778_1034344796 3 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344796 7:150379503-150379525 CCGGCCCGGGCTGGGGCGGAGGG 0: 1
1: 0
2: 7
3: 61
4: 454
1034344778_1034344790 -4 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344790 7:150379496-150379518 CCTCCGCCCGGCCCGGGCTGGGG 0: 1
1: 0
2: 5
3: 43
4: 382
1034344778_1034344801 9 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344801 7:150379509-150379531 CGGGCTGGGGCGGAGGGATGGGG 0: 1
1: 0
2: 5
3: 84
4: 896
1034344778_1034344800 8 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344800 7:150379508-150379530 CCGGGCTGGGGCGGAGGGATGGG 0: 1
1: 0
2: 2
3: 53
4: 525
1034344778_1034344798 7 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344798 7:150379507-150379529 CCCGGGCTGGGGCGGAGGGATGG 0: 1
1: 0
2: 15
3: 99
4: 974
1034344778_1034344787 -6 Left 1034344778 7:150379477-150379499 CCCCGCTCCTCCCGTGCTGCCTC 0: 1
1: 0
2: 2
3: 52
4: 433
Right 1034344787 7:150379494-150379516 TGCCTCCGCCCGGCCCGGGCTGG 0: 1
1: 0
2: 2
3: 37
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034344778 Original CRISPR GAGGCAGCACGGGAGGAGCG GGG (reversed) Intronic
900154294 1:1197879-1197901 CAGGCAGCACGGCTGGGGCGCGG - Exonic
900183127 1:1321128-1321150 GAGGCAGCACAGGGGGCGGGGGG - Intronic
900391586 1:2436203-2436225 GAGGCAGGAAGGAAGGAGGGAGG - Intronic
900391597 1:2436240-2436262 GAGGGAGGAGGGGAGGAGGGAGG - Intronic
900391624 1:2436317-2436339 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
900391638 1:2436355-2436377 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
900391644 1:2436370-2436392 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
900391679 1:2436474-2436496 GAGGGAGGAGGGGAGGAGGGAGG - Intronic
900391701 1:2436536-2436558 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
900391717 1:2436580-2436602 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
900435994 1:2631596-2631618 GGGACAGGAAGGGAGGAGCGAGG - Intronic
900457902 1:2786251-2786273 GAGGCAGTAGGGGAGGATCGGGG - Intronic
900473070 1:2864014-2864036 GGGGCAGCACGGGAGGTGCTTGG - Intergenic
900586408 1:3434512-3434534 GAGGCAGAACAAGAGGCGCGGGG + Exonic
900932866 1:5747748-5747770 GAGGGAGAAAGGGAGGAGGGAGG + Intergenic
900956840 1:5891518-5891540 CAGACCGCACGGGAGGAGCCCGG - Intronic
901457433 1:9371298-9371320 GGGGCAGCAGGGGAGGAGTGGGG + Intergenic
902250938 1:15153868-15153890 GAGGCCGCCCGGGTGGGGCGCGG + Intronic
902873530 1:19327934-19327956 TAGGAAGCAGGGGAGGAGCCAGG - Intronic
903838161 1:26219364-26219386 GAGGGAGCACAGCAGGGGCGGGG - Intergenic
904349126 1:29893642-29893664 GAGGGAGCAGGGCAGGAGCTGGG - Intergenic
904420296 1:30386767-30386789 GAGGCAGCAAGGGATCAGCAAGG - Intergenic
904445587 1:30570918-30570940 GAGGCAGCAGGGGAGGTCCCAGG - Intergenic
904784163 1:32973127-32973149 GATGCGGCACGCGAGGGGCGGGG - Intergenic
904943072 1:34178130-34178152 TTGGCAGCAAGGGAGGAGGGAGG + Intronic
905548126 1:38816295-38816317 GAGCCTGCCGGGGAGGAGCGAGG - Intergenic
906065405 1:42976994-42977016 GAGGCTGCACGGGAGCACTGGGG + Intergenic
906286511 1:44591329-44591351 GAGGCAGCAAGAGAGGAGGCTGG + Intronic
907159118 1:52358472-52358494 GAGACAGCATGGGAGGGGCAGGG + Intronic
907898966 1:58720060-58720082 GAGTAAGCAAGGGAGGAGGGAGG - Intergenic
910053807 1:83007878-83007900 GAGGCAGCACGGCAGCGGCTAGG - Intergenic
910271165 1:85396391-85396413 GAGGGAGCAAGAGAGGAGTGGGG + Intronic
910449072 1:87328798-87328820 GAGGAGGAGCGGGAGGAGCGCGG + Exonic
911513059 1:98831647-98831669 GAGGAAGCAGAGGAGGAGGGAGG - Intergenic
912391779 1:109307841-109307863 GAGGCAGCAGTGGTGGAGGGAGG + Intergenic
913107720 1:115629780-115629802 GAGGCAGGATGGGAGCACCGTGG - Intergenic
914004229 1:143718263-143718285 GAGGCAGAAGGGCAGGAGCGGGG + Intergenic
915926805 1:160028263-160028285 GAGCCAGCAAGGGAGGAGGCAGG - Exonic
915973332 1:160368784-160368806 CAGGCAGCAAGGGTGGAGAGGGG + Intronic
916552915 1:165866041-165866063 GAGGAAGAAGGGGAGGAGCAGGG + Intronic
917930179 1:179817465-179817487 GGGGCAGCAAGGGAAGAGAGGGG + Intergenic
920198053 1:204242714-204242736 GAGACAGCATGGGTGGAGTGGGG + Intronic
920440397 1:205976962-205976984 GAGCCAGCACGGGAACAGGGGGG - Exonic
920509640 1:206541398-206541420 GAGGCAGCTGGGGAGGAAGGAGG + Intronic
920697450 1:208192092-208192114 CAGGCAGCACGGGCTGAGAGAGG - Intronic
920956041 1:210620971-210620993 AAGGAAGCACGGTAGGAGCTGGG + Intronic
921374040 1:214455010-214455032 GAGGAAGAACGGGAGGAGTAGGG - Intronic
923429340 1:233905368-233905390 GCGGCGGGAAGGGAGGAGCGCGG + Intronic
923519363 1:234724143-234724165 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
923565909 1:235075767-235075789 GAGACAGCAAGGAAGGAGCTGGG + Intergenic
923687551 1:236163870-236163892 GAGGCAGTATGGGAGGTGTGAGG - Intronic
924383502 1:243483511-243483533 GAGGAGGCACTGGAGGAGAGAGG - Intronic
924813803 1:247425568-247425590 CAGGCAGCATGAGAGGAGCTTGG - Exonic
1063298585 10:4831281-4831303 GAAGCAGCACGGCAGGTGCAGGG + Intronic
1064112345 10:12550073-12550095 GGGGCAGCCCAGGAGGAGAGGGG + Intronic
1065099800 10:22321510-22321532 GAGGCGGCATGAGACGAGCGTGG + Exonic
1065590410 10:27256862-27256884 GAGGAGCCAGGGGAGGAGCGGGG - Intergenic
1065629253 10:27660534-27660556 GAGGGAGCAAAGGAGGAGAGAGG + Intergenic
1065974153 10:30827991-30828013 GAGGCACCAGGGGAGGAGAGGGG + Intronic
1066047046 10:31603473-31603495 GGGGAAGCACGGGAGGAGGGAGG + Intergenic
1067085805 10:43237519-43237541 GAGGCAGCTCAGGAGGAGCCGGG - Intronic
1067145248 10:43689466-43689488 GGGGCAGGACAGGAGGAGCCGGG + Intergenic
1067368656 10:45661342-45661364 GCTGCAGCAAGGGAGGAGCAGGG - Intronic
1067549903 10:47226961-47226983 GAGGCAGCCAGGGAGGAATGTGG + Intergenic
1067596976 10:47565821-47565843 GAGGCAGCAAGGGCTGAGCCCGG + Intergenic
1069615235 10:69802508-69802530 GTGGCGGCGCGGGCGGAGCGCGG + Exonic
1071985596 10:91047160-91047182 GAGGCAGGCTGGGAGGAGGGAGG - Intergenic
1072786241 10:98284926-98284948 GAGCCAGCACTGGAGAAGCCTGG - Intergenic
1073048970 10:100655949-100655971 GAGGAAGCAGGGGAGGAGGGAGG - Intergenic
1073268302 10:102241436-102241458 GAGGCGGCCCGGGAGCAGGGGGG - Exonic
1074399095 10:113126942-113126964 GACGCAGCAGGGCAGGCGCGCGG - Intronic
1075316733 10:121459225-121459247 GAGAAAGCAGGAGAGGAGCGGGG - Intergenic
1075559130 10:123455867-123455889 GAGGCAGCACTTTAGGAGTGGGG + Intergenic
1076436891 10:130452697-130452719 GTCACAGCACGGGAGGAGCCTGG + Intergenic
1076872991 10:133202665-133202687 GAGGCGGCAGGAGAGGAGCAAGG - Intronic
1077185750 11:1234700-1234722 GAGGCAGCAGGTGGGGAGGGCGG + Intronic
1077201633 11:1310209-1310231 GAGCGAGCAGGAGAGGAGCGGGG - Intergenic
1077233945 11:1470908-1470930 CTGGCAGCACGGGAGTGGCGTGG + Intronic
1077249840 11:1556068-1556090 GAGGGAGCAGGGGAGGTGGGTGG + Exonic
1077536078 11:3124914-3124936 GAGGCAACAGGGGAAGAGAGAGG + Intronic
1078402500 11:11040397-11040419 GAGGCAGCATGGTTGGAGGGAGG + Intergenic
1079032265 11:16994553-16994575 GAGGCTGTACGGGAGGAAGGTGG - Intronic
1080867949 11:36212284-36212306 GAGACAGCACGGGAAGGGGGTGG - Intronic
1081102659 11:39024433-39024455 GAGGGAGGAAGGGAGGAGGGAGG - Intergenic
1082862737 11:57871348-57871370 GAGGCAGCAAGGGCGGAGGCAGG - Intergenic
1083254313 11:61486879-61486901 GAGGCAGCAGGGATGGAGAGGGG - Intronic
1083257500 11:61505732-61505754 GGGGAAGCAGGGGAGGAGAGAGG - Intergenic
1083477514 11:62923636-62923658 GAGGCAGGAGGGGAGAAGAGAGG + Intergenic
1083744072 11:64725678-64725700 GAGGCAGCACAGGAGGCAGGCGG + Intergenic
1083802317 11:65053707-65053729 GAGGCAGCAAGGCTGGAGCCAGG + Intronic
1083862828 11:65433855-65433877 GAGGCGGCAGGGGAGGCGGGTGG - Intergenic
1084091384 11:66881388-66881410 GAGGCAGCAGGGGAGGAAGCAGG - Intronic
1084365020 11:68692274-68692296 GAGGCAGCCAGGGTGGAGCTGGG - Intergenic
1084625002 11:70299712-70299734 GTGGCAGCAGGGGAGCAGAGGGG - Intronic
1084736495 11:71108752-71108774 GAGGCAGGACTGCATGAGCGAGG - Intronic
1084796353 11:71507282-71507304 GAGGCCCCACGGGAGGAGAGTGG - Intronic
1084872102 11:72105297-72105319 GAGACAGCACAGGAGAAGAGGGG + Intronic
1085263698 11:75223992-75224014 GAGGCAGCCGGGGAGGAGGAGGG + Intergenic
1088455009 11:110024128-110024150 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1088991785 11:114960383-114960405 GAGGCAGGGCTGGAGGAGGGAGG + Intergenic
1089457318 11:118633209-118633231 GAGGCAGCATTAGAGGAGAGAGG - Intronic
1092182169 12:6453319-6453341 GAGGGAGCCCGGGAGGACCAAGG - Intronic
1092229324 12:6767902-6767924 GAGACAGCACGGGAGCACAGCGG - Intronic
1095160321 12:38906731-38906753 GAGGCAGGAGGGAAGGCGCGGGG - Intronic
1096771564 12:53939013-53939035 GCGGCGGCACGGGCGGAGCGGGG + Exonic
1096868749 12:54580162-54580184 GAGGCAGCTTGGCAGGAGGGTGG + Exonic
1099202410 12:79691102-79691124 GAGGCGGCGCGCGAGGGGCGCGG + Intergenic
1099385280 12:82006175-82006197 GAGGGAGCAGGGGAGGGGAGGGG + Intergenic
1100549204 12:95631054-95631076 GAGGGAGTAGGGGAGGAGCAGGG + Intergenic
1101876161 12:108598091-108598113 GAGGAGGGACGGGAGGAGGGAGG - Exonic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1102713856 12:114952862-114952884 GAGGCACCACGCAAGGAGTGAGG - Intergenic
1104311121 12:127655149-127655171 CCGGCTGCCCGGGAGGAGCGTGG - Intergenic
1104657202 12:130582123-130582145 GAGACAGCAGAGGAGGAGGGAGG - Intronic
1105211385 13:18259066-18259088 GATGCAGCAGGGGTGGGGCGTGG + Intergenic
1105783629 13:23725926-23725948 GAGCCTGCACAGCAGGAGCGGGG + Intergenic
1106088350 13:26562851-26562873 GAGGGAGGAGGGGAGGAGAGGGG - Intronic
1106226901 13:27792900-27792922 GAGGCAGCGCGGGCGGCCCGGGG - Exonic
1110254370 13:73416270-73416292 GAGGCAGCAAGGAAGGAGGGCGG + Intergenic
1111048465 13:82846914-82846936 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1111048471 13:82846929-82846951 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1111048477 13:82846944-82846966 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1112441498 13:99427350-99427372 GAGGATGAAAGGGAGGAGCGAGG + Intergenic
1112857997 13:103794374-103794396 GATGGAGCAGGGCAGGAGCGAGG - Intergenic
1113777303 13:112955131-112955153 GAGGCAGCAGGAGAGGAGTGAGG + Intronic
1114490077 14:23095024-23095046 AAGGCCGCACTGGAGCAGCGAGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1119168173 14:72513135-72513157 GAGGGAGCACAGGAGGACAGAGG - Intronic
1119480017 14:74953274-74953296 GAGGCAGGGAGGGAGGAGCGAGG + Intronic
1119760350 14:77146421-77146443 GAGGAGGCTCGGGAGGAGCAGGG + Intronic
1120978072 14:90266959-90266981 GGGCCAGCACGGGAGGAGTGTGG - Intronic
1121210397 14:92204056-92204078 GAGGGAGCAAGAGAGGTGCGGGG - Intergenic
1121618906 14:95332554-95332576 GAGGCAGGAAGGGAGGAATGAGG - Intergenic
1122582230 14:102777859-102777881 GAGGCAGCCCGGCTGGGGCGCGG - Intronic
1123434934 15:20247876-20247898 GAGGGAGGAGGGGAGGAGAGGGG + Intergenic
1124658340 15:31526173-31526195 AAGGACGCACGGGAGGACCGTGG - Intronic
1125617867 15:41031599-41031621 GAGGGAGGAAGGGAGGAGGGAGG + Intronic
1125748854 15:42015142-42015164 GGGGCAGCTCGGGAGGGACGTGG - Intronic
1126065101 15:44820437-44820459 AAGGCAGCATGGCAGGAGCAAGG + Intergenic
1126094729 15:45080146-45080168 AAGGCAGCATGGCAGGAGCAAGG - Intergenic
1126809260 15:52384115-52384137 GAGCCAGAAAGGAAGGAGCGTGG + Intronic
1126955018 15:53923914-53923936 GAGACAGCACGGGCTGGGCGCGG + Intergenic
1128733589 15:70036935-70036957 GAGGGAGGAAGGGAGGAGGGAGG - Intergenic
1129576109 15:76747701-76747723 GAGGCAGTAAGAGAGGAGGGAGG - Intronic
1129710211 15:77817029-77817051 GAGCCAACAAGGGAGGAGCAGGG + Intronic
1129712727 15:77828795-77828817 GAGTTTGCAGGGGAGGAGCGAGG + Intergenic
1129733390 15:77944535-77944557 GAGGCACCAGGGGTGAAGCGAGG - Intergenic
1130747987 15:86676666-86676688 GAGGCAGGAGGAGAGGAGGGTGG - Intronic
1130967078 15:88705499-88705521 GAGGGAGCCCGGGCGGCGCGCGG - Intergenic
1131049272 15:89335475-89335497 GAGGCAGCACCGGATGGGCGAGG - Intergenic
1132084883 15:98900053-98900075 GTGAGAGCACGGGAGGAGCATGG + Intronic
1132147070 15:99435336-99435358 GGGCCGGCAAGGGAGGAGCGGGG + Intergenic
1132359731 15:101202189-101202211 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359745 15:101202252-101202274 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359761 15:101202315-101202337 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359775 15:101202378-101202400 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359815 15:101202567-101202589 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132359829 15:101202630-101202652 GAGGCTGCAGGGGAGGATGGAGG + Intronic
1132958915 16:2611631-2611653 GAGGCAGGAGGGAAGGAGGGCGG - Intergenic
1133115594 16:3576392-3576414 GTGACAGCACAGGAGGGGCGAGG - Intronic
1135956384 16:26959805-26959827 GAGGAAGAGAGGGAGGAGCGGGG - Intergenic
1136366555 16:29811818-29811840 GAGGCTGCAGAGGAGGAGCAGGG - Intronic
1136616655 16:31402302-31402324 GAGGCATCCCGGGAGGGGTGGGG + Intronic
1137275690 16:46931937-46931959 GAGGGAGCACTGGAGGCCCGTGG + Intergenic
1137505393 16:49049909-49049931 GAGGCATCAGGGGAGGAGCTGGG - Intergenic
1137764839 16:50970095-50970117 GAGTCAGCAAGGGATGAGCTGGG + Intergenic
1138281383 16:55774433-55774455 CAGGCAGAACAGGCGGAGCGCGG + Intergenic
1138541945 16:57693673-57693695 AAGGCAGGAAGGGAGGAGGGAGG - Intergenic
1138544362 16:57706869-57706891 GAGGATGCATGGGAGGAGAGAGG - Intronic
1139524575 16:67506579-67506601 GAGGCAGCAGGAGGGGAGGGAGG + Intergenic
1139958515 16:70704731-70704753 GAGCCCGCTCGGGAGGAGCTGGG + Intronic
1139968968 16:70762011-70762033 GAGGCAGCACAGGACAGGCGGGG - Intronic
1141455345 16:84137501-84137523 AACGCAGCAGGGGAGGAGGGGGG + Intronic
1141461097 16:84179327-84179349 GAGGCAGCAGGGCAGGACCTCGG - Exonic
1141820540 16:86442526-86442548 GAGGCAGCATGGGGGGTGGGGGG - Intergenic
1142163393 16:88570803-88570825 GAGGCAGCGCGCGAGGAGCTCGG - Intronic
1142217915 16:88838905-88838927 GAGGCAGCTCGGGAGGTCCAGGG - Intronic
1142270311 16:89085579-89085601 GAGGCAGCAAGGGAGGGGCAGGG - Intergenic
1142958188 17:3535271-3535293 GAGGGAGGAAGGGAGGAGGGAGG - Intronic
1143223572 17:5282097-5282119 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223575 17:5282108-5282130 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223578 17:5282119-5282141 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223581 17:5282130-5282152 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223584 17:5282141-5282163 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223587 17:5282152-5282174 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223590 17:5282163-5282185 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1143223593 17:5282174-5282196 GAGGGAGCGCGGAGGGAGCGCGG - Intergenic
1144512992 17:15893502-15893524 GAGGAAGAAAGGGAGGAGGGAGG - Intergenic
1145250202 17:21293294-21293316 GAGGCAACACGGGAGGACCCCGG - Intronic
1145904338 17:28508019-28508041 CAGGCAGCGCGGGCGGGGCGGGG - Intronic
1147258984 17:39197705-39197727 GAGGGAGCGAGGGAGGGGCGCGG - Intergenic
1147285779 17:39401730-39401752 GGGGCGGGAGGGGAGGAGCGCGG + Intronic
1147702482 17:42404637-42404659 GAGGAAGTTCGGAAGGAGCGAGG + Exonic
1147819702 17:43234414-43234436 GAGGCTCCAGGGCAGGAGCGCGG + Intergenic
1147821012 17:43241812-43241834 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147821818 17:43246301-43246323 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147826551 17:43273727-43273749 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147827440 17:43278605-43278627 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147828548 17:43284766-43284788 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147830742 17:43297049-43297071 GAGGCCCCAGGCGAGGAGCGCGG + Intergenic
1147831434 17:43300668-43300690 GAGGCCCCAGGGCAGGAGCGCGG + Intergenic
1147840633 17:43369031-43369053 GGGGCTGGGCGGGAGGAGCGGGG + Intergenic
1148020133 17:44548031-44548053 GAGGCAGCAGAGGGGGAGGGGGG - Intergenic
1148820732 17:50358173-50358195 GAGGCAGCTGGGCAGGAGTGTGG - Intronic
1150124483 17:62627624-62627646 GAGGCAGCCCGGGCGGAGGGAGG - Exonic
1150228167 17:63534932-63534954 GGGGCAGCAAGGTAGGAGGGTGG - Intronic
1151155414 17:72120849-72120871 GAGGCGGGAGGGGAGGAGAGGGG - Intergenic
1151352989 17:73542629-73542651 GAGGCAGCAAGGGGAGAGGGAGG + Intronic
1151362958 17:73599592-73599614 GAGGGAGCAAGGAAGGAGGGAGG + Intronic
1151535020 17:74734238-74734260 GAGGCAAGATGGGAGGAGTGTGG - Intronic
1151535166 17:74735200-74735222 GAGGGAGGAAGGGAGGAGAGGGG + Intronic
1151856692 17:76726806-76726828 GCGGCAGCGCGGGAGGGGAGGGG - Intergenic
1152126408 17:78450010-78450032 GAGGCACCAGGGGAAGAGCAGGG + Intronic
1152210434 17:79000422-79000444 GAGGCAGGAGGGGTGGAGGGAGG - Intronic
1152608480 17:81304516-81304538 GGGGCAGCAAGGGAGCAGCAAGG - Intergenic
1152853079 17:82648787-82648809 GAGGCAGGGCGGGCGGGGCGGGG + Intergenic
1152933694 17:83124043-83124065 GAGGAAGCTGGGGAGGAGCGTGG + Intergenic
1152961877 18:84768-84790 GACGGGGCACAGGAGGAGCGAGG - Intergenic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1154411252 18:14143379-14143401 GAGGCAGGATGGGAGGAGTGTGG - Intergenic
1158097696 18:53793077-53793099 GAGGCAGCAGGGGAGTACAGTGG - Intergenic
1158500404 18:57995744-57995766 GAGGAAGGACAGGAGGAGGGAGG + Intergenic
1159809607 18:73001457-73001479 GAGGCAGAATGGGGGGAGCAGGG + Intergenic
1159951861 18:74489946-74489968 GAGGGAACAAGGGAGGAGGGAGG + Intergenic
1160571152 18:79818423-79818445 CAGGCAGCGGGGGAGGAGGGAGG - Intergenic
1160629971 18:80240005-80240027 GAGGCAACGGGGGAGGAGCCAGG + Intronic
1160798786 19:957602-957624 AAGGCAACACGTGAGGATCGAGG + Intronic
1160807797 19:1000326-1000348 GAGGCCGCCCGGGCGGAGCGCGG + Intergenic
1160916849 19:1500826-1500848 GAGGGAGGAGGGGAGGAGGGAGG + Intergenic
1160926068 19:1546459-1546481 GAGGCAGTGGGGTAGGAGCGAGG + Intergenic
1160930350 19:1567249-1567271 GAGCGCGCAGGGGAGGAGCGCGG + Intronic
1161024702 19:2030963-2030985 GAGGCAGCGCTAGAGGAGCGAGG - Intronic
1161177946 19:2858950-2858972 GAGGAGGCACGTGAGGAGCTTGG - Exonic
1162018235 19:7857033-7857055 GAGGCAGAGCGGAAGGCGCGGGG - Intronic
1162836727 19:13324224-13324246 GAGGCTGCAGGGGAGGAGGAGGG + Intronic
1163334089 19:16660310-16660332 GAGCCAGAATGGGAGGAGCGGGG + Intronic
1163388780 19:17016820-17016842 GAGGAAGGAAGGGAGGAGGGAGG + Intronic
1163641932 19:18466929-18466951 GAGGCAGCTCAGCAGGGGCGAGG - Intronic
1164703570 19:30303360-30303382 GAGGCAGTGCGGGAGGTGCAGGG + Intronic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1164998736 19:32743393-32743415 AAGGGAGCAGGGGAGGAGAGCGG - Intronic
1165799046 19:38536463-38536485 GAGGTAGAAAGGCAGGAGCGAGG - Intronic
1166332959 19:42089256-42089278 GAGGAAGGAGGGGAGGAGAGAGG + Intronic
1166332965 19:42089275-42089297 GAGGAAGGAGGGGAGGAGAGAGG + Intronic
1166340556 19:42134431-42134453 GAGCCAGCATGGGAGGCGAGAGG - Intronic
1166381346 19:42356844-42356866 GCGGCTGCATGGAAGGAGCGGGG - Exonic
1166738877 19:45102349-45102371 GAGGCAGCACGGGAGCCCCCTGG + Intronic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1167299856 19:48672172-48672194 GAGGCAGGAAGGCAGGAGCTGGG + Intronic
1167374137 19:49102237-49102259 CAGGCAGCTCAGGAGCAGCGAGG + Intronic
1167750826 19:51379292-51379314 GACGCATCAGGGGAGGAGAGAGG + Intergenic
1168327426 19:55545418-55545440 GAGGCAACACGGGGAGAGAGAGG - Intronic
1168333900 19:55586048-55586070 GAGGCTGCACGGGAGAGGGGGGG - Intergenic
1168587008 19:57601839-57601861 GAGCCAGCAAGGCAGGAGGGAGG + Intronic
925599393 2:5592073-5592095 GAGGCAGCCCTGGAGGAGTGAGG + Intergenic
926235460 2:11039873-11039895 GAGGCAGGGAGGGAGGAGAGGGG - Intergenic
926660471 2:15460089-15460111 GAGGCAGCAAGGGAGGAATGAGG + Intronic
927810847 2:26179529-26179551 GGGGCTGGAAGGGAGGAGCGAGG + Intronic
929284013 2:40115325-40115347 GAGGCAGGATGTGAGGAGCTTGG + Exonic
929668481 2:43851878-43851900 AAGGCAGCAGGGGAGGAGCGGGG - Intronic
930798684 2:55419984-55420006 GCAGCTGCACGGGAGGGGCGGGG - Intergenic
931627884 2:64273141-64273163 GAGACAGCAGGGCAGGAGAGAGG - Intergenic
932236567 2:70125273-70125295 GCGGCAGCGTGGCAGGAGCGAGG - Intergenic
932741189 2:74292323-74292345 GAGGTAGCATGGGAGGAGCATGG - Intronic
933899044 2:86836138-86836160 GAGCCAGCAGGGGAGGTGCTGGG + Intronic
934776415 2:96940418-96940440 GAGGCAGATCGGGTGGGGCGAGG + Intronic
935580202 2:104750085-104750107 GAGGCAGCTAGTGAGGAGGGTGG + Intergenic
936066069 2:109333072-109333094 GAGGCAGCACTGGAGCTGCAGGG - Intronic
936368672 2:111884202-111884224 GGGGCATCGCGGGAGGTGCGCGG + Exonic
937122853 2:119452768-119452790 GAGGCAGCAGGGCAGCAGCGAGG - Intronic
937125306 2:119471624-119471646 GAGAAAGCACGGGTGGAGAGTGG - Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
940323240 2:152399298-152399320 GTGGCAGCACAGGATGAGGGAGG + Intronic
942452628 2:176117732-176117754 AGGGCAGCAGGGGAGAAGCGGGG - Intronic
946179335 2:217940444-217940466 GAGGCACCAGGGCAGGAGCGAGG - Intronic
946227227 2:218270448-218270470 TAGGCAGGACGGAAGGAGCGGGG + Intronic
947111207 2:226721414-226721436 GAGGGAGCAAGGAAGGAGGGAGG + Intergenic
947791983 2:232873727-232873749 GAGGCAGCACGCCAGGGGCCTGG + Intronic
948061283 2:235044790-235044812 GACGCAGCCCGGCAGGAGTGGGG + Intronic
948230028 2:236342676-236342698 GCTGCAGCAGGAGAGGAGCGGGG - Intronic
1168777736 20:462245-462267 GAGGCGGCGCCGGAGGGGCGCGG - Intronic
1169257625 20:4111051-4111073 GAGGCAGAAAGGGCTGAGCGGGG - Intergenic
1169344532 20:4820066-4820088 GAGGCACCAGGGAAGGAGGGTGG - Intronic
1169972122 20:11279317-11279339 GAGGCAGGTCAGGAGGAGCCTGG - Intergenic
1170041667 20:12045410-12045432 GGGGCAGGAGGGGAGGAGAGGGG - Intergenic
1171400827 20:24872199-24872221 GATGCAGCAGGGGAGCAGAGTGG + Intergenic
1172785975 20:37469267-37469289 GAGGCAGGAAGGAAGGAGAGAGG - Intergenic
1173427855 20:42958316-42958338 GAGGGAGCAAGGGAGGAGGGAGG + Intronic
1173530941 20:43769179-43769201 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1173919098 20:46730636-46730658 GAGGGAGGAAGGGAAGAGCGTGG + Intronic
1174434339 20:50495004-50495026 GAGGCAGCAGGTGAGGAGTGGGG + Intergenic
1174984597 20:55436586-55436608 TAGTCAGCACGGGAAGAGAGAGG - Intergenic
1175851896 20:62098104-62098126 GAGGAAGCAGGAGAGGAGCCAGG + Intergenic
1175865740 20:62175397-62175419 GTGGGAGCACTGCAGGAGCGAGG + Intronic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176270494 20:64233397-64233419 GAGGAAGAAGGGGAGGAGAGGGG - Intronic
1176299120 21:5090314-5090336 GAGGCAGCAGTGCAGGAGCCAGG + Intergenic
1176309379 21:5141710-5141732 GAGGCAGGACAGGAGGGGCAGGG + Intronic
1179299171 21:40090992-40091014 GAGGCAGAAATGGAGGAGGGTGG - Intronic
1179517673 21:41919942-41919964 GGGGGAGCACGGGAGAAGAGGGG + Intronic
1179847682 21:44120323-44120345 GAGGCAGGACAGGAGGGGCGGGG - Intronic
1180166529 21:46033590-46033612 GAGGCAGCACGGGGTGCGGGGGG + Intergenic
1180166548 21:46033643-46033665 GAGGCAGCACGGGGTGTGGGGGG + Intergenic
1180166575 21:46033712-46033734 GAGGCAGCACGGGGTGTGGGGGG + Intergenic
1180166588 21:46033746-46033768 GAGGCAGCACGGGGTGTGGGGGG + Intergenic
1180166610 21:46033813-46033835 GAGGCAGCACGGGATGCCGGGGG + Intergenic
1181459846 22:23079440-23079462 GAGGCAGCATGGCAGGAGTGGGG + Intronic
1181656978 22:24309956-24309978 GAGGGAACAGGGGAGGAGAGGGG - Intronic
1182676460 22:32043161-32043183 GAGGGAGCAGGGCAGTAGCGCGG - Exonic
1183149987 22:36029176-36029198 GGGGCAGCGCGGGGGGGGCGGGG + Intergenic
1183363373 22:37394482-37394504 GAGGCTGCCCGGGAGGAGGGCGG - Intronic
1183546173 22:38455692-38455714 GAGGCAGCGCGGGCAGAGGGAGG - Intergenic
1183714825 22:39527515-39527537 GGGGTAGCACTGGAGGAGAGAGG - Intergenic
1183779325 22:39988714-39988736 GTGGCAGCAGGGAAGGAGGGAGG + Intergenic
1184029666 22:41884733-41884755 GAGGAACCAGGGGAGAAGCGAGG - Intronic
1184560357 22:45259567-45259589 GAGGCAGGAGGGCAGGAGTGAGG - Intergenic
1184691451 22:46119179-46119201 GAGGCAGCAGGGGAGGGCAGGGG + Intergenic
1185108026 22:48885346-48885368 GTGGGAGGACGGGAGGAGGGAGG - Intergenic
1185272691 22:49936084-49936106 GGGGCGGCGGGGGAGGAGCGCGG - Intergenic
950186820 3:10950629-10950651 GAGGCAGCAGGGGTGCAGAGAGG - Intergenic
950206522 3:11085112-11085134 GGAGCAGCAGGGGAGGAGTGGGG - Intergenic
950793156 3:15489427-15489449 GAGGCAGCTCAGGTGGAGTGGGG + Intronic
952390242 3:32873762-32873784 GATGCAGGACGGGAGGAGGAGGG - Intronic
952974175 3:38680152-38680174 GAGGCAGCATGGGAGGAACATGG - Intergenic
953447677 3:42981351-42981373 GAAGCAGCATGGGAGGAGACAGG + Intronic
953856515 3:46503452-46503474 GAGGAAGCAAGAGAGGTGCGGGG + Intergenic
953989886 3:47475851-47475873 GCGGCAGCAGGGGCGGAGCGCGG + Exonic
955479858 3:59378609-59378631 GAGGGAGGAAGGGAGGAGGGAGG - Intergenic
955814323 3:62825921-62825943 AAGGCATCAGGGGAGAAGCGAGG + Intronic
959240861 3:103792343-103792365 GAGGAAGGAAGGGAGGAGAGGGG - Intergenic
960710117 3:120519361-120519383 GAGGCTGCATGGGAAGAGCATGG + Intergenic
961735807 3:129001592-129001614 GAGGAGGGACCGGAGGAGCGAGG + Intronic
962559527 3:136591245-136591267 GAGGGAGGAAGGGAGGAGGGAGG + Intronic
963051274 3:141146094-141146116 GAGGCAGCTCTGGAAGAGGGTGG - Intronic
963357091 3:144222039-144222061 GAGGCAGGGCTGGAGGAGCCAGG + Intergenic
964401535 3:156304664-156304686 GAGGCAGGACTGGAGCAGTGTGG + Intronic
964665720 3:159169785-159169807 GAGGCAGCACTGCAAGAGGGTGG + Intronic
967997524 3:195178169-195178191 GGGGCAGAAGGGGAAGAGCGAGG - Intronic
968008776 3:195259931-195259953 GCGGCAGCACGGTCGGAGGGAGG - Intronic
968317390 3:197736482-197736504 GAGGAAGGACGGGCGGGGCGGGG - Intronic
968607306 4:1541630-1541652 GAGGCAGTTGGGGAGGAGAGTGG - Intergenic
968613882 4:1568768-1568790 GAGGCGGCGCGGGTGGAGTGGGG - Intergenic
968760925 4:2442538-2442560 GAGGAGGCACGGGCTGAGCGGGG - Intronic
969512324 4:7625803-7625825 GAGGAAGGAGGGGAGGAGAGAGG + Intronic
969660168 4:8522805-8522827 GAGGGAGCAGGGCAGGAGCTGGG + Intergenic
970320191 4:14867855-14867877 GAGGGAGCACAGTAGGAGGGAGG - Intergenic
972865261 4:43224519-43224541 GAGGTAGCACGGTGGGTGCGGGG + Intergenic
976085239 4:81401079-81401101 AAGACAGCAAGGGAGCAGCGGGG - Intergenic
977607319 4:98995914-98995936 GAGCCAGCAGGGGAGAAGCGAGG - Intronic
981044603 4:140253316-140253338 AAGGCAGCGCAGGCGGAGCGCGG - Intergenic
982370419 4:154627231-154627253 AAGGCGGCAAGGGAGGCGCGAGG + Intronic
982712201 4:158768931-158768953 GCGGCGGCGCGGGAGGAGCGCGG - Intergenic
983940382 4:173529978-173530000 GAGAGAGCGCGAGAGGAGCGAGG - Exonic
984714733 4:182915900-182915922 GAGTCAGCACAGGAGGAGGGTGG + Intronic
984752339 4:183289849-183289871 GTGGCAGCAGGGGATGGGCGTGG + Intronic
985050942 4:185990345-185990367 GAGGCAGTGAGGGAGGAGCTTGG + Intergenic
985714585 5:1448226-1448248 GAGGCAGCACCCAAGGAGGGGGG - Intergenic
985765517 5:1777449-1777471 GACGCCGCACGGGAGGCGCAGGG - Intergenic
986105775 5:4658117-4658139 GAGGCAGAAGGGGAGGATGGAGG - Intergenic
986387730 5:7251832-7251854 GAGGTAGCATGGGAGGAGAGTGG - Intergenic
987774139 5:22342544-22342566 GAGGAAGGAAGGGAGGAGGGAGG - Intronic
990792865 5:59501570-59501592 GAGGCAGCTGGGGAGGAAAGAGG + Intronic
992643841 5:78793933-78793955 GGGGCAGCATGGGAGGAAAGTGG + Intronic
993671174 5:90763668-90763690 GAGGCAGCAGGGTAGGAGTGGGG - Intronic
993799663 5:92317234-92317256 AAGGCAGGAAGGGAGGAGGGAGG - Intergenic
993840913 5:92877212-92877234 GAGGCAGCAAGGCAGGGGTGAGG - Intergenic
997485264 5:134225891-134225913 GCGGCGGCGCGGGAGCAGCGCGG - Exonic
997665692 5:135628019-135628041 GAGGCACCACCTGAGGAGGGTGG + Intergenic
998012745 5:138708526-138708548 GAGGCAGCAGGAGAGGAGAAAGG - Intronic
998119018 5:139561289-139561311 GGGGCAGGTCGGGAGGCGCGGGG - Exonic
998136581 5:139677276-139677298 CAGGCAGCAGGGGAGGAGTCAGG - Intronic
998377958 5:141703419-141703441 GAGGGAGCTCTGGGGGAGCGGGG + Intergenic
999188467 5:149730254-149730276 GAGCGAGCAAGGGAGGAGGGAGG - Intergenic
999452944 5:151692075-151692097 GAGGAAGAACGGGAGGAGATGGG - Intergenic
999525928 5:152405367-152405389 TAGGCTGCACTGGAGGAGAGGGG + Intronic
1000052342 5:157574550-157574572 GAGCGAGCACCGGCGGAGCGAGG - Intronic
1001404391 5:171465677-171465699 GAGGCAGCAAGAGAGGAAGGTGG + Intergenic
1002060022 5:176620561-176620583 GAGGCAACACTGGAGGGGCGAGG + Exonic
1002092374 5:176812905-176812927 AAGGCAGCGCGGGAGGAGCCCGG - Intronic
1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG + Intronic
1003049727 6:2768291-2768313 GAGACAGCACGGAAGGATCTAGG - Intronic
1004114126 6:12749856-12749878 GAGGACGCCCGGGAGGGGCGGGG - Intronic
1004127768 6:12890041-12890063 GGGGCAGCAGGAGATGAGCGAGG + Intronic
1004160232 6:13206154-13206176 GAGGGAGGACGGGAGGAGAGGGG + Intronic
1005676325 6:28159206-28159228 GAGGCAGCACAGAATGAGGGAGG - Exonic
1005890882 6:30136905-30136927 GAGGCAGCCCTGGAGCAGCCTGG - Exonic
1005983818 6:30857755-30857777 CAGGCAGCCCGGGAGCAGTGAGG - Intergenic
1005992746 6:30913782-30913804 TCGGCAGGACGGGAGGGGCGCGG - Intronic
1006139552 6:31920244-31920266 TTGGCAGCACTGGAGGAGTGAGG + Intronic
1006423506 6:33949852-33949874 GAGGCAGCACGGGAGCAGCCAGG + Intergenic
1006443576 6:34066851-34066873 GCGGCACCACGTGAGGACCGCGG - Intronic
1006444378 6:34070601-34070623 GAGGCAGGAGGGCAGGAGCTCGG + Intronic
1007073978 6:39055107-39055129 GAGGCAGCAAGGGGTGAGCAAGG + Intronic
1007375922 6:41456720-41456742 GAGACAGGAAGGGAGGAGAGAGG - Intergenic
1007750652 6:44068700-44068722 GAGGCAGCAGGGAAGGGGCAAGG + Intergenic
1011271840 6:85587947-85587969 GCTTCAGCAGGGGAGGAGCGGGG + Intronic
1011670019 6:89674415-89674437 GGGGCAGCACTGGAGGAGCCAGG + Exonic
1013492113 6:110658137-110658159 GAGGCAGCAAGACAGGAGCATGG + Intronic
1016989275 6:149918314-149918336 GAGGCAGCAAAGGATGAGGGTGG + Exonic
1016993852 6:149947368-149947390 GAGGCAGCAAAGGATGAGGGTGG - Exonic
1017004481 6:150020169-150020191 GAGGCAGCAAAGGATGAGGGTGG + Exonic
1017913926 6:158818320-158818342 GAGGGGGCACGGGCGGGGCGGGG + Intronic
1018751111 6:166807463-166807485 GAGGGAGCAGGGCAGAAGCGGGG - Intronic
1019266793 7:121611-121633 GAGGCAGGAGGGAAGGAGGGGGG + Intergenic
1019315511 7:382488-382510 GAGGGAGGAAGGGAGGAGGGAGG + Intergenic
1019350010 7:550161-550183 GAGGCAGCCGGGGAGGCGTGTGG + Exonic
1019400358 7:848691-848713 GAGGCAGCGAGGGAGGCGCCTGG - Intronic
1019479531 7:1260140-1260162 GTGCCAGCACAGGAGGAGGGGGG + Intergenic
1019517545 7:1446518-1446540 GAGGGAGAAGGGGAGGAGAGGGG + Intronic
1019521646 7:1463399-1463421 GAGACAGGAGGGGAGGAGGGAGG + Intergenic
1020013735 7:4819591-4819613 GAGGCGGCGCGGGAGGGGCCTGG + Intronic
1021601060 7:22363923-22363945 GAGGCAGCACGGGAAGACTTGGG - Intergenic
1022162635 7:27726951-27726973 GAGGCAGGGAGGGAGGAGGGAGG + Intergenic
1023213049 7:37829251-37829273 GAGGCAGATCTGGAGGAGCCTGG - Intronic
1023743899 7:43304232-43304254 GAGGCAGTACAGGAGAAGTGGGG - Intronic
1024226394 7:47329331-47329353 GAGGCAGCCCAGGAGGAACGGGG - Intronic
1024965332 7:55018970-55018992 GAGGCAGGGCGGGAGGAGGAGGG - Intergenic
1026982428 7:74534592-74534614 GAGGCAGAGCTGGGGGAGCGAGG + Intronic
1027232524 7:76281018-76281040 GAGAGAGCAAGGGAGGAGAGAGG - Intronic
1028216525 7:88140077-88140099 GAGGGAGCAGGGGAGAAGGGAGG + Intronic
1030053476 7:105560455-105560477 GCGGGGGCACGGGAGGAGAGAGG + Intronic
1031483332 7:122303447-122303469 GAGGAAGGAAAGGAGGAGCGAGG + Intronic
1033207648 7:139436611-139436633 GAGGCAGGACATGAGGAGCCCGG + Intergenic
1033737575 7:144238694-144238716 GAGGGATCACTGGAGGAGCTGGG + Intergenic
1034344778 7:150379477-150379499 GAGGCAGCACGGGAGGAGCGGGG - Intronic
1034814987 7:154164269-154164291 GAGGAAGGAGGGAAGGAGCGGGG - Intronic
1035153750 7:156895498-156895520 GAGGCAGCAGAGGAGGTGAGAGG + Intergenic
1035584320 8:760238-760260 CAGGCAGCAAGGGAGGAGACAGG - Intergenic
1035619207 8:1024656-1024678 GAGGCAACAGAGGAGGAGTGCGG + Intergenic
1035776265 8:2191187-2191209 GAGGGAGGAAGGGAGGAGGGAGG - Intergenic
1035933475 8:3810437-3810459 AAGGGAGCACGGGAGGACCTGGG + Intronic
1036470680 8:9049841-9049863 GAGGCCGCAGGTGAGGAGAGAGG + Intronic
1036638008 8:10564711-10564733 GAGGCAGGAGGGGAAGAGGGTGG + Intergenic
1037400331 8:18489266-18489288 GAGACAGCAGGAGAGGAGAGAGG + Intergenic
1037884523 8:22589265-22589287 GAGGCAGCCGGGGAGGAGTCAGG - Exonic
1039821704 8:41140822-41140844 GAGGAAGCAGGAGAGGAGAGGGG + Intergenic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1040457181 8:47610499-47610521 GAGGCAAAAGGGGAGGAGAGGGG - Intronic
1041659134 8:60384061-60384083 GTGGCAGGAGGGGAGGAGAGAGG - Intergenic
1043581482 8:81720971-81720993 GAGGCAGGGCCTGAGGAGCGGGG - Intronic
1045582794 8:103499386-103499408 GAGGGAGAACGTGAGGAGGGAGG - Intergenic
1047454699 8:124998415-124998437 GGGGCAGCACGCGGGGCGCGCGG + Intergenic
1048497716 8:134948848-134948870 GAGGGAGCACTGGCGGAGCTTGG - Intergenic
1049057945 8:140254002-140254024 CAGGCAACACGGGAGGAAGGGGG + Intronic
1049302794 8:141880446-141880468 GAGGCATCACGGGAGCCCCGTGG - Intergenic
1049358962 8:142202827-142202849 GGGGCAGCATGGGAGGATCACGG - Intergenic
1049499378 8:142953431-142953453 GAGGCAGCAGGGGTGGGGAGGGG - Intergenic
1049566351 8:143341134-143341156 GCGGCAGCACGAGAAGAGGGTGG - Intronic
1051605272 9:18912114-18912136 GAGGCCCCACGGCAGGAGGGAGG + Intergenic
1053157558 9:35791551-35791573 GAGGCAGCGGGGGAGGGGCGGGG + Intergenic
1055238134 9:74149163-74149185 CAGGCAGCAGCGGAGGAGCAAGG - Intergenic
1058822352 9:108744332-108744354 GAGGTGGCACGGGATGAGGGTGG + Intergenic
1059354214 9:113687013-113687035 GAGGAAGGAAGGGAGGAGGGAGG + Intergenic
1059439970 9:114301345-114301367 GATGCAGCACTGCAGGGGCGGGG + Intronic
1059451225 9:114372551-114372573 GAGGAAGGAAGGGAGGAGGGAGG + Intronic
1059499307 9:114737502-114737524 GAGGCAGAAGGGGAGGGGAGGGG - Intergenic
1060148736 9:121272985-121273007 GAGCAAGCAAGGGAGGAGGGAGG - Intronic
1061308685 9:129748276-129748298 GGGGCAGAACGGGAAAAGCGTGG + Intronic
1061517104 9:131096422-131096444 GAGGCGGGAGGGGAGGGGCGAGG + Intergenic
1061559597 9:131394119-131394141 GAGCGAGCCCGGGAGGAGGGAGG + Intronic
1061762103 9:132858132-132858154 GAAGCAGCACGGGAGCAACTGGG - Intronic
1061887482 9:133599110-133599132 GAGGCAGGACAGGAGGAGGGTGG - Intergenic
1061969850 9:134039055-134039077 GAGGGAGGAGGGGAGGAGCATGG - Intronic
1062017954 9:134301136-134301158 GAGGGAGAAAGGGAGGAGAGGGG + Intergenic
1062062137 9:134502390-134502412 GAGGCAGAAAGGGAGAAGCTGGG - Intergenic
1062243298 9:135551065-135551087 GAGTCAGCACGTGAGAAGCTGGG + Intergenic
1062489983 9:136800269-136800291 GAGGGCTCACGGGAGGGGCGGGG + Intronic
1062521517 9:136959838-136959860 GAGGCAGCCTGGGAGGGGCTGGG + Intergenic
1062635412 9:137487931-137487953 TTGGCCACACGGGAGGAGCGGGG + Intronic
1062729811 9:138102635-138102657 GCGGCAGCAGGAGGGGAGCGGGG - Intronic
1186269178 X:7866451-7866473 GGGGCAGGAGGGGAGGAGGGAGG - Intergenic
1186788537 X:12975191-12975213 GAGGCAGGACGGCAGGAGGAAGG - Exonic
1188107386 X:26160880-26160902 GAGGCATCACGGGAGGTACTAGG - Intergenic
1188107405 X:26161006-26161028 GAGGCATCACGGGAGGTGCTTGG - Intergenic
1188110782 X:26194126-26194148 GAGGCATCACGGGAGGTGCTTGG - Exonic
1188986964 X:36776610-36776632 ATGGGAGCACGGGAGGAGGGAGG - Intergenic
1189323130 X:40098021-40098043 GAGGGAGGACGGGCGGAGGGAGG - Intronic
1189657090 X:43255828-43255850 GAAGCAGGAGGGGAGGAGTGTGG - Intergenic
1190302567 X:49065204-49065226 GAAGCAGCACAGGAGGGGCTGGG - Intronic
1190321052 X:49179409-49179431 CAGGCATCAAGGGAGGAGCCTGG - Intronic
1191937356 X:66439837-66439859 GAGGGAGCATGGAAGGAGGGAGG + Intergenic
1192207734 X:69107344-69107366 GAGGCAGCAGGAGAGGAGGTTGG - Intergenic
1192699883 X:73457600-73457622 GGGCCAGCAAGGGAGGAGGGTGG + Intergenic
1195684091 X:107570173-107570195 GAGGGAGGAAGGGGGGAGCGGGG + Intronic
1197650681 X:129060274-129060296 GAGGGAGCAAGGGAGACGCGAGG - Intergenic
1200052615 X:153443010-153443032 GTGGCAGCAGGGGAGGGGAGGGG - Intergenic
1200243166 X:154508239-154508261 GAGGGAGCAGGGAAGGAGGGCGG + Intronic
1201741175 Y:17325882-17325904 GAGGGAGCAAGGAAGGAGAGAGG + Intergenic