ID: 1034349156

View in Genome Browser
Species Human (GRCh38)
Location 7:150405311-150405333
Sequence GCGCCATGTGAGTGCGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034349146_1034349156 22 Left 1034349146 7:150405266-150405288 CCGGCGACTGCGGCGCTGCAGCG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1034349156 7:150405311-150405333 GCGCCATGTGAGTGCGCGCGGGG 0: 1
1: 0
2: 1
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034349156 Original CRISPR GCGCCATGTGAGTGCGCGCG GGG Intronic