ID: 1034349156 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:150405311-150405333 |
| Sequence | GCGCCATGTGAGTGCGCGCG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 50 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 44} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034349146_1034349156 | 22 | Left | 1034349146 | 7:150405266-150405288 | CCGGCGACTGCGGCGCTGCAGCG | 0: 1 1: 0 2: 0 3: 5 4: 73 |
||
| Right | 1034349156 | 7:150405311-150405333 | GCGCCATGTGAGTGCGCGCGGGG | 0: 1 1: 0 2: 1 3: 4 4: 44 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034349156 | Original CRISPR | GCGCCATGTGAGTGCGCGCG GGG | Intronic | ||