ID: 1034353089

View in Genome Browser
Species Human (GRCh38)
Location 7:150429909-150429931
Sequence GACTTACTCTCTTAGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034353089_1034353091 6 Left 1034353089 7:150429909-150429931 CCAGAACGCTAAGAGAGTAAGTC No data
Right 1034353091 7:150429938-150429960 GTTCAAGCCACTTTTTGTGGTGG No data
1034353089_1034353090 3 Left 1034353089 7:150429909-150429931 CCAGAACGCTAAGAGAGTAAGTC No data
Right 1034353090 7:150429935-150429957 GTTGTTCAAGCCACTTTTTGTGG No data
1034353089_1034353093 24 Left 1034353089 7:150429909-150429931 CCAGAACGCTAAGAGAGTAAGTC No data
Right 1034353093 7:150429956-150429978 GGTGGTTTATTATGCAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034353089 Original CRISPR GACTTACTCTCTTAGCGTTC TGG (reversed) Intergenic
No off target data available for this crispr