ID: 1034353438

View in Genome Browser
Species Human (GRCh38)
Location 7:150432299-150432321
Sequence ATGGAGAAACACAGTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034353435_1034353438 -6 Left 1034353435 7:150432282-150432304 CCAAACTACAGGGTGTCATGGAG No data
Right 1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG No data
1034353431_1034353438 8 Left 1034353431 7:150432268-150432290 CCGCTTGGCTGTGGCCAAACTAC No data
Right 1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034353438 Original CRISPR ATGGAGAAACACAGTCTGGT GGG Intergenic
No off target data available for this crispr