ID: 1034353878

View in Genome Browser
Species Human (GRCh38)
Location 7:150435519-150435541
Sequence CCTCGTGACCCCAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034353878_1034353888 15 Left 1034353878 7:150435519-150435541 CCATCTGCTCTGGGGTCACGAGG No data
Right 1034353888 7:150435557-150435579 CTTTCATGGCCTAGAAAGCGTGG No data
1034353878_1034353883 1 Left 1034353878 7:150435519-150435541 CCATCTGCTCTGGGGTCACGAGG No data
Right 1034353883 7:150435543-150435565 AAAGGGCCCCTCTCCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034353878 Original CRISPR CCTCGTGACCCCAGAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr