ID: 1034354541

View in Genome Browser
Species Human (GRCh38)
Location 7:150442400-150442422
Sequence ACACAACACTGTCGCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034354541_1034354546 -4 Left 1034354541 7:150442400-150442422 CCACCAGGGCGACAGTGTTGTGT No data
Right 1034354546 7:150442419-150442441 GTGTGTGCGGGTGGAAGCACAGG No data
1034354541_1034354549 30 Left 1034354541 7:150442400-150442422 CCACCAGGGCGACAGTGTTGTGT No data
Right 1034354549 7:150442453-150442475 TGTGATGAACCCCAGCAAGGAGG No data
1034354541_1034354547 -3 Left 1034354541 7:150442400-150442422 CCACCAGGGCGACAGTGTTGTGT No data
Right 1034354547 7:150442420-150442442 TGTGTGCGGGTGGAAGCACAGGG No data
1034354541_1034354548 27 Left 1034354541 7:150442400-150442422 CCACCAGGGCGACAGTGTTGTGT No data
Right 1034354548 7:150442450-150442472 TATTGTGATGAACCCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034354541 Original CRISPR ACACAACACTGTCGCCCTGG TGG (reversed) Intergenic