ID: 1034356722

View in Genome Browser
Species Human (GRCh38)
Location 7:150456392-150456414
Sequence CAGAGGAAGGAGCAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1411
Summary {0: 1, 1: 5, 2: 15, 3: 166, 4: 1224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034356722_1034356726 -2 Left 1034356722 7:150456392-150456414 CCTGGCTCCTGCTCCTTCCTCTG 0: 1
1: 5
2: 15
3: 166
4: 1224
Right 1034356726 7:150456413-150456435 TGTCTTTAAAGCTAGCAATGTGG 0: 1
1: 0
2: 3
3: 16
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034356722 Original CRISPR CAGAGGAAGGAGCAGGAGCC AGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900164555 1:1239545-1239567 CTGAGGGGGCAGCAGGAGCCAGG - Intergenic
900311189 1:2033946-2033968 CAGAGGCAGGAGCTAGAGCAGGG + Intergenic
900315086 1:2052365-2052387 AAGAGGAAGGGGTGGGAGCCTGG - Intronic
900370652 1:2330663-2330685 CCGAGGAGGGAGGAGGAGCTTGG + Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900496890 1:2979784-2979806 CAGAGGTGGAAGCAGGAGGCTGG - Intergenic
900598029 1:3491234-3491256 CAGGGGAGGGCGCAGGACCCAGG + Intronic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900633496 1:3651061-3651083 CGGAGGTACGAGCAGGACCCTGG - Intronic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902614680 1:17617394-17617416 CAGAGGAATGGACTGGAGCCTGG - Intronic
902614956 1:17618672-17618694 CAGAGCAAGGTACAGGTGCCGGG - Intronic
902705447 1:18201124-18201146 TAGAGGAAGGAGCTTGAGCTGGG + Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902840394 1:19070525-19070547 CAGGGCCCGGAGCAGGAGCCGGG + Intergenic
903169144 1:21541390-21541412 CAGAGGCAGGATCAGAATCCAGG + Intronic
903212132 1:21824277-21824299 GAGAGGAAGGGCCAGGTGCCAGG + Exonic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903479016 1:23639630-23639652 CTGAGCAAGGAGCTGGTGCCAGG - Intronic
903578168 1:24351985-24352007 TAGAGGAACAAGCAGGAGGCAGG - Intronic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903589617 1:24444756-24444778 CAGTGGAAGAAGTAAGAGCCTGG + Intronic
903738300 1:25544008-25544030 CTGAGGAAGGAGCCCGAGCTCGG + Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
904035029 1:27554289-27554311 GAGAGGATGTAGCAGGGGCCAGG - Intronic
904045519 1:27606037-27606059 GAGAGAAAGGAGGAGGAACCTGG - Intergenic
904215382 1:28914732-28914754 CAGTGGCGGGCGCAGGAGCCCGG + Intronic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
904587576 1:31588681-31588703 GAAAGGAAGGAGCACCAGCCTGG - Intergenic
904712908 1:32444478-32444500 TAGAGGAAGGTGCAGGTGACGGG + Intergenic
905012227 1:34755361-34755383 CAAAGGTAGGAGCAGGGGCCAGG + Intronic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905108350 1:35577156-35577178 AAGGGGAAGGGGCAGGAGCCGGG + Intronic
905271769 1:36792098-36792120 CAGAGCAAGAAGCAGAACCCAGG + Intergenic
905456340 1:38090627-38090649 GAGAGGGAGGAGCAGGAGTTGGG + Intergenic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905907090 1:41626364-41626386 CACAGGCAGAGGCAGGAGCCAGG + Intronic
906052618 1:42887553-42887575 CAGAGGCAGGACCAGCAGCGCGG + Intergenic
906197567 1:43938429-43938451 CAGAGGCAGGAGCTGCAGCCGGG + Intergenic
906407148 1:45551019-45551041 CGGAGGGAGGGGCAGGGGCCGGG - Exonic
906640748 1:47439137-47439159 CTGAGGCAGGCGCAGGAGCTGGG - Exonic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906869091 1:49456720-49456742 CAGAGGAAAGGGTAGGAGCGGGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907999123 1:59663278-59663300 AAGTGGAAAGAGCAGAAGCCTGG - Intronic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
909159307 1:72125883-72125905 CACAGGAAAGAACAGAAGCCAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913182352 1:116334318-116334340 GAGAGGAAGGAAGAGAAGCCAGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913230468 1:116736778-116736800 CAGAGGAAATGGCAGAAGCCAGG - Intergenic
913287607 1:117241162-117241184 CAGAGGAGCCAGCAGGAGCTGGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913968226 1:143394281-143394303 CCAAGGAGGGAACAGGAGCCTGG + Intergenic
914062605 1:144219873-144219895 CCAAGGAGGGAACAGGAGCCTGG + Intergenic
914116545 1:144746481-144746503 CCAAGGAGGGAACAGGAGCCTGG - Intergenic
914449815 1:147781137-147781159 CAAATGAAGGCGCTGGAGCCAGG - Intergenic
915191869 1:154157601-154157623 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
915262093 1:154684289-154684311 CTGAGGCAGGAGCATGAACCCGG + Intergenic
915268003 1:154732449-154732471 CAGAGGTGGAAGCAGAAGCCTGG + Intronic
915342121 1:155182260-155182282 AGGAGGAAGTAGTAGGAGCCTGG + Intronic
915601538 1:156925609-156925631 TATGGGAAGGAGCAGGAGCAAGG + Intronic
915629288 1:157138833-157138855 CACAGGAAGGCCCAGGCGCCGGG + Intergenic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915893699 1:159794646-159794668 CTGAGGAAGGAGCTTGAACCCGG + Intergenic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916325600 1:163556404-163556426 TAAGGGAAGGAGCAGGGGCCAGG - Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916918762 1:169439527-169439549 GACAGGCAGGTGCAGGAGCCAGG + Intronic
917087532 1:171318919-171318941 GACAGGCAGGTGCAGGAGCCAGG + Intronic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917403962 1:174683430-174683452 GACAGGAACAAGCAGGAGCCTGG + Intronic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919905457 1:202075507-202075529 CTGGGGTAGGGGCAGGAGCCAGG - Intergenic
920031497 1:203040074-203040096 TGCAGGAGGGAGCAGGAGCCTGG + Intronic
920373476 1:205493857-205493879 CAGCGGCTGGAGCTGGAGCCTGG + Intergenic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920556206 1:206906847-206906869 CAGAGGATGGTGCAGCAACCAGG - Intronic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921944947 1:220879936-220879958 AAGGGGAAGGAGCAGCCGCCTGG - Exonic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922232138 1:223696661-223696683 CAGAGAAGAGAGCAGGTGCCGGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
922790259 1:228307288-228307310 CAGAGTCTGGAGCAGGAGACAGG + Exonic
923291781 1:232552886-232552908 CACAGGCAGGTGCAGGAACCAGG + Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923417065 1:233773309-233773331 AAGAGGGAGGAGGAGGTGCCAGG + Intergenic
924495764 1:244586858-244586880 CAGAGGGAGAACCAGGACCCTGG + Intronic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1062799713 10:369977-369999 CCGTGGAGTGAGCAGGAGCCGGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1063953288 10:11243911-11243933 CAGAGGAAGGAGGTGGCCCCTGG + Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1065081792 10:22136466-22136488 TTGGGGAATGAGCAGGAGCCAGG - Intergenic
1065104876 10:22372650-22372672 CTGAGGTGGGAGCAGCAGCCTGG + Intronic
1065172241 10:23043062-23043084 CAAAGCAAGCAGCATGAGCCAGG + Intergenic
1065210303 10:23396314-23396336 CCCAGGAAGGAGCTGGAGCAAGG - Intergenic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065544461 10:26805289-26805311 CAGAGGTCTGAGCAGTAGCCTGG + Intronic
1065547698 10:26838408-26838430 AAGAGGAAGGAGCAGAGGACAGG + Intronic
1065925997 10:30434233-30434255 CAGCGGCAGAAGCAGGAACCAGG - Exonic
1065966517 10:30775223-30775245 CAGAGCAGTTAGCAGGAGCCAGG + Intergenic
1066210221 10:33229722-33229744 CAGAGGAAGGAGCAATTGACTGG + Intronic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066478730 10:35774036-35774058 CAGAGGAATGATTAGGAGCATGG + Intergenic
1066649199 10:37639354-37639376 CAGAGGGTGGTGCAGGAGCACGG + Intergenic
1067288831 10:44926949-44926971 AAGAGGAAGCACCAGAAGCCAGG + Intronic
1067430991 10:46245774-46245796 CACAGTAAGGACCTGGAGCCAGG + Intergenic
1067442417 10:46316454-46316476 CACAGTAAGGACCTGGAGCCAGG - Intronic
1067527798 10:47048754-47048776 CTGAGGAGGGCGCTGGAGCCTGG + Intergenic
1067759674 10:49035235-49035257 GAGAGGTGGGAGCATGAGCCTGG - Intronic
1067766627 10:49091987-49092009 GGCAGGAGGGAGCAGGAGCCAGG + Intronic
1067947063 10:50696368-50696390 CACAGGTAGGAGGAGGAGCTGGG - Intergenic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069246888 10:66217959-66217981 TAGGGGAAGGAGCTGGAGCCAGG + Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1069999307 10:72364491-72364513 AACAGGAAGGAGGAGGAGACAGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070525497 10:77292634-77292656 AAGAGAAAGGAGCTGGGGCCTGG - Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1070889894 10:79935369-79935391 CACAGGGAGAAGCAGAAGCCAGG + Intergenic
1071198642 10:83191797-83191819 CAGTGGCAGGAGTAAGAGCCAGG + Intergenic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071746594 10:88426742-88426764 GACAGTAAGGAGGAGGAGCCAGG + Intronic
1071982146 10:91014228-91014250 AAGAAGAAAGGGCAGGAGCCTGG + Intergenic
1072294261 10:93994109-93994131 CCCAGGAACGCGCAGGAGCCAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072535296 10:96357947-96357969 GAGAGGAAGGAGGAAGAGACAGG + Intronic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1072614159 10:97038376-97038398 AAGAGGCTGCAGCAGGAGCCCGG - Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1072944398 10:99796832-99796854 AGGAGGAAGGAGCAAGAGCAGGG + Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073250488 10:102117964-102117986 CTGGGGGAGGAGGAGGAGCCCGG + Intronic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073455440 10:103634068-103634090 CAGAGGTAGGAGCGGAGGCCAGG + Intronic
1073481044 10:103786296-103786318 CACAGGTAGGTGGAGGAGCCAGG - Intronic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1074112272 10:110431083-110431105 CAGAAGGAGGAGCAGGGGCTAGG - Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074547127 10:114409693-114409715 CAGAGGATTGAGCATGAGCTAGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075178131 10:120184703-120184725 TTGAGGGAGGAGCTGGAGCCAGG + Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075633238 10:124013922-124013944 CAGGGGAAGGAGGACTAGCCAGG - Intronic
1075646079 10:124097440-124097462 CAGTGGCAGGAGCAGGACCTGGG - Intergenic
1075848719 10:125568346-125568368 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1076197243 10:128527716-128527738 CAGGGGAGGGAGCGGGAGCTGGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076846590 10:133072248-133072270 CTGAGGAAGGGGCAGAAGCCTGG + Intronic
1076886396 10:133264746-133264768 CAGAGGCTGCAGCAAGAGCCGGG - Intronic
1076886403 10:133264786-133264808 CAGAGGCTGCAGCAGGAACCAGG - Intronic
1076886413 10:133264826-133264848 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886430 10:133264905-133264927 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886455 10:133265024-133265046 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886464 10:133265064-133265086 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886481 10:133265143-133265165 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886490 10:133265183-133265205 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886499 10:133265223-133265245 CAGAGGCTGCAGCAGGAGCTGGG - Intronic
1076886509 10:133265263-133265285 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886519 10:133265303-133265325 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077076199 11:703297-703319 CAGGAGTGGGAGCAGGAGCCAGG + Exonic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077474242 11:2778896-2778918 GTGGGGCAGGAGCAGGAGCCTGG - Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078110468 11:8388024-8388046 GAGAGGAACCAGCAGAAGCCTGG + Intergenic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079131612 11:17750049-17750071 CAGAGGAAGGATCAGAACCCAGG - Intronic
1079349833 11:19683162-19683184 CTGAGGAAGGAAGAGTAGCCGGG + Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1080268349 11:30424656-30424678 GAGGGGAGGGAGCAGGGGCCAGG - Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080665047 11:34328438-34328460 CAGAGGAAGCAGCAGAGGCTTGG - Intronic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081543898 11:44056111-44056133 CTAGGGAAGGAGGAGGAGCCAGG + Intronic
1081875959 11:46408539-46408561 GAGAGGGAGGTGCCGGAGCCAGG - Exonic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082987901 11:59183752-59183774 CAGAGGTAGGAGTAGGGGCTGGG - Intronic
1083272169 11:61578084-61578106 CAGAGTGTGGAGCTGGAGCCTGG + Intronic
1083280969 11:61627138-61627160 CAGAGGCAGGAGCAGGCCCAGGG - Intergenic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083616367 11:64028482-64028504 GGAAGGAAGGAGCAGGAGGCAGG + Intronic
1083648369 11:64186140-64186162 GCGAGGAAGGGGCGGGAGCCGGG + Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083903421 11:65654848-65654870 CAGGGGCAGGGGCTGGAGCCTGG + Exonic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1084182658 11:67454508-67454530 GGGTGGAAGGAGCAGGAGCAGGG + Intronic
1084219500 11:67668393-67668415 AGGAGGAAGGATCAGGACCCTGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084363951 11:68685708-68685730 CAGGCGGAGGGGCAGGAGCCAGG - Intronic
1084487748 11:69460707-69460729 CAGAGGGTGGAGCAAGAGCCTGG + Intergenic
1084513925 11:69625362-69625384 AAGAGGAAGAAGCTGGAGCTTGG + Intergenic
1084639328 11:70415116-70415138 TAGAGGAGCGATCAGGAGCCTGG + Intronic
1084642416 11:70433753-70433775 CAGAGGCAGGCGCAGCTGCCTGG - Intronic
1084721286 11:70907120-70907142 CAGAGGAAGCAGCTGGGGACTGG + Intronic
1085018673 11:73191507-73191529 CAGAGGAGGGAACTGGAACCTGG + Intergenic
1085119188 11:73956400-73956422 CAGAGGGAGAAGCAGGGGCTTGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086066812 11:82754294-82754316 CAGTGGAAGAAGCATTAGCCTGG + Intergenic
1086286112 11:85253479-85253501 TAGAAGCAGGTGCAGGAGCCAGG + Intronic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1088217508 11:107529108-107529130 CAGAGCCAGGATCAGAAGCCAGG - Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089060043 11:115618920-115618942 CAGAGGCAGCAGCAGCACCCAGG - Intergenic
1089070516 11:115696106-115696128 AGGATGTAGGAGCAGGAGCCAGG + Intergenic
1089154543 11:116390973-116390995 CAGAGGACAGATCAGGACCCAGG + Intergenic
1089560631 11:119341456-119341478 CAAAGGAAGGAGCATCAGCAGGG - Exonic
1089609737 11:119662756-119662778 CAGAGGGAGGTGGAGGAGCTGGG - Exonic
1089689860 11:120180584-120180606 CAGAGCTTGGGGCAGGAGCCTGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090429972 11:126637474-126637496 CAGAGGCTTGAGCAGGAGGCTGG - Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090590383 11:128261098-128261120 GACAGGCAGGCGCAGGAGCCGGG + Intergenic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090908331 11:131096632-131096654 CAGTGGCAGAGGCAGGAGCCTGG + Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091760745 12:3085599-3085621 TACAGGTAGGAGCAGGAGCCAGG - Intronic
1092713508 12:11363758-11363780 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1092717219 12:11402974-11402996 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1092766390 12:11856653-11856675 GAGAGGAAGTAGCTGGAGGCAGG - Intronic
1092961295 12:13598833-13598855 CACAGGAAGGAGTAGCTGCCAGG - Intronic
1093061537 12:14612300-14612322 CTGATGAAAGATCAGGAGCCTGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093775489 12:23068872-23068894 TAGAGTAAGGAGCATGTGCCAGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1093939846 12:25041105-25041127 CAGAGCAAGGAGCCGGTGCCAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094499579 12:31010028-31010050 CAGAGCTAGGAGCTGGAACCAGG + Intergenic
1094796528 12:33979617-33979639 TCGAGGAAAGAGCAGGAGCTGGG + Intergenic
1095307927 12:40660141-40660163 CAGAGGAGGGAATAGGATCCAGG - Intergenic
1095435786 12:42186258-42186280 CAGAGGCAGGAGCTTGAACCTGG + Intronic
1095508076 12:42919845-42919867 CAGAGGGAGGAACAAGAGCCAGG - Intergenic
1095863915 12:46950695-46950717 TAGAGAAAGGATCAGAAGCCAGG - Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096546226 12:52341972-52341994 CCTAGCATGGAGCAGGAGCCAGG + Intergenic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096596432 12:52698839-52698861 CAGAGGAGGAAGCAGGATTCTGG - Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1096916000 12:55034405-55034427 CAGTGGGCTGAGCAGGAGCCAGG - Intergenic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1098744047 12:74213301-74213323 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1100107046 12:91188331-91188353 AAAAGGCAGGAGCAGGACCCAGG - Intergenic
1101344270 12:103871323-103871345 TAGAGGAAGAAGCAAGAGACAGG + Intergenic
1101443743 12:104722629-104722651 CACAGGAAGGAACAGGTGCCAGG - Intronic
1101444043 12:104724562-104724584 CAGGGTTAGGAGCAGCAGCCAGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102389684 12:112539548-112539570 CAGAGTCAGGAGCAGAACCCAGG - Intergenic
1102461055 12:113099887-113099909 CGGAAGGAGGAGCAAGAGCCAGG - Exonic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103343615 12:120234881-120234903 CAGGGGGAGGAGTCGGAGCCAGG + Intronic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1103912923 12:124362147-124362169 CCGGGGCAAGAGCAGGAGCCCGG - Exonic
1104007557 12:124904575-124904597 CCAGGGAAGGAGCAGGACCCTGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104367762 12:128193278-128193300 CAGAGGAAGGAGCCTGGCCCCGG + Intergenic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1104557357 12:129813002-129813024 AAGTGGAAGGCGCAGGAGTCGGG - Intronic
1104786716 12:131455062-131455084 CAGGGGTGGGGGCAGGAGCCAGG - Intergenic
1104839753 12:131817497-131817519 CTGAGGACGGCGCAGCAGCCTGG + Intergenic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104893502 12:132151214-132151236 CAGCGGATGGAGCAGGGCCCGGG - Intronic
1104926661 12:132317361-132317383 GAGTGGAAGGAGCAGGAGAGAGG - Intronic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105722380 13:23129222-23129244 CAAAGGAAGGAGTAGGAGTAGGG + Intergenic
1105899964 13:24745574-24745596 CACAGCAAGGACCAGGAGCACGG + Intergenic
1106131558 13:26943925-26943947 GAGAGGAAGGAAGAGAAGCCAGG - Intergenic
1106717852 13:32409666-32409688 GAGAGAAAGGGTCAGGAGCCGGG + Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1110683317 13:78342020-78342042 TTGAGGAAGAAGCAGGAGCATGG - Intergenic
1110781928 13:79476467-79476489 TAGAGGAAGGAACAGGAGAAAGG - Intergenic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113499229 13:110760176-110760198 CAGAGGAGGAAGCAGCAGGCAGG + Intergenic
1113635007 13:111913390-111913412 GAGAGGGAGGAGGAGAAGCCTGG - Intergenic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1113944431 13:114035900-114035922 CAGAGGCTGTAGCAGGAGGCTGG + Intronic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114525747 14:23366086-23366108 GCGAGGGAGGAGCAGGGGCCCGG + Intergenic
1114578571 14:23736133-23736155 CAGAGGAAGGAGGGAGAGCAAGG + Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116268047 14:42721148-42721170 GAGAGGAGTGAGCAGGAGCATGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117729967 14:58712569-58712591 CAGAGGGAGGAGCCGTGGCCAGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118370048 14:65130165-65130187 GAGAGGCAGGCACAGGAGCCGGG - Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118903998 14:70010354-70010376 GAGAGGTGGGTGCAGGAGCCTGG - Intronic
1118992446 14:70809088-70809110 GGGAGGATGGAGCAGGGGCCGGG - Exonic
1119196098 14:72717762-72717784 CAGCAGAAGGAGCAGGACCTAGG + Intronic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119282022 14:73417371-73417393 GACAGGCAGGTGCAGGAGCCAGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119432569 14:74578077-74578099 GAGGGGCTGGAGCAGGAGCCAGG + Intronic
1119748281 14:77059801-77059823 CAGCTGGAGGAGCGGGAGCCAGG + Intergenic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1119920241 14:78439958-78439980 AAAAGGAAGGAGCAGGTGCCAGG - Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121114693 14:91335443-91335465 CAGAGGCAGGAGCAAAGGCCTGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121209782 14:92199600-92199622 CTGAGGAAGGGGGAGAAGCCTGG - Intergenic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121339388 14:93096138-93096160 CACAGGAGGGAGCCGGAGCTTGG - Intronic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122406157 14:101502308-101502330 CAGATGATGGAGCAGCAGCAAGG + Intergenic
1122429013 14:101628221-101628243 CAAAGGCAGGATCAGGACCCTGG + Intergenic
1122509011 14:102250737-102250759 TAAAGGAAGGAGCACGAGCCTGG + Intronic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122779585 14:104138158-104138180 CCGAGGAAGGGGCGGGACCCCGG - Intergenic
1122816072 14:104314734-104314756 CACAGAAGAGAGCAGGAGCCAGG - Intergenic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1123711185 15:22988960-22988982 CAAGGGAAGGAGCAGGATCCGGG - Intronic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124154939 15:27217574-27217596 CACAGCACGGAGCAGGATCCTGG - Intronic
1124371281 15:29106247-29106269 GTGTGGAAGGAGCAGGAACCAGG + Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1125158247 15:36614216-36614238 CAGAGGGAGGAGCAGCAGCAGGG - Intronic
1125323293 15:38511269-38511291 TAGAGCAAGGAGCTGGAGCGAGG + Intronic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125462331 15:39919607-39919629 CCGAGGATGGAGCGGGATCCAGG - Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1125999384 15:44195015-44195037 GAGCGGCAGCAGCAGGAGCCTGG - Exonic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1126668016 15:51092844-51092866 AAGAGGAAGGAAGAGAAGCCGGG - Intronic
1127267443 15:57373708-57373730 GAGAGTGAGGACCAGGAGCCAGG - Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1127920923 15:63493537-63493559 CAGAGGAAACAGCTCGAGCCAGG + Intergenic
1128146916 15:65337046-65337068 GGGAGCCAGGAGCAGGAGCCAGG - Intronic
1128182225 15:65613985-65614007 GAGAGGAAGGGGCTGGAGCTTGG - Intronic
1128217486 15:65944516-65944538 GAGAGGCAGCAGCAGGAGCCTGG + Intronic
1128598610 15:68976028-68976050 GAGAGGCACGAGCAGGAACCGGG - Intronic
1128617048 15:69118341-69118363 CAGAGGGAGAAGGAGGAGCTAGG - Intergenic
1128670015 15:69567716-69567738 GAGAGGCACGAGCAGGAACCCGG - Intergenic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1128758013 15:70196375-70196397 CTGAGGAAGGGACAGCAGCCCGG + Intergenic
1129272656 15:74427694-74427716 CTGGGGGAGGAGGAGGAGCCAGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129312943 15:74725165-74725187 TAGGGGATGGAGCTGGAGCCTGG + Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129682154 15:77663970-77663992 CAGAGGCTGGGGCAGGACCCGGG + Intronic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130137938 15:81197288-81197310 CAGGGGCAGGAGCAGAAGCCAGG + Intronic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1130747203 15:86668036-86668058 GAGAGAGAGGAGCAGGTGCCAGG + Intronic
1131108860 15:89751678-89751700 TAGAGTAAGGACCAGGAGCAGGG + Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131403671 15:92146195-92146217 CAAAGGGAGGAGCAGGGGCTGGG - Intronic
1132352128 15:101146425-101146447 AAGAGGAAGGAGGAAGAGACAGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1132767623 16:1542419-1542441 TTGAGGAAGGGGCAGGACCCAGG - Intronic
1132768317 16:1546384-1546406 CAGAGCCAGGAGCAGAACCCAGG - Intronic
1133268619 16:4599755-4599777 CAGAGGAGGGAGCAGAGGCTCGG + Intronic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133740354 16:8646644-8646666 AAGAGGCAGGAGCTGGCGCCAGG + Exonic
1134279320 16:12803722-12803744 CAGAGCCAGGGGCAGGACCCTGG - Exonic
1134302151 16:13001313-13001335 GAGAGGGAGGAGCAGGTCCCCGG - Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134857886 16:17535876-17535898 CTGAGGGAGGAGGAGGAGCTAGG - Intergenic
1135175238 16:20221958-20221980 AAGAGGCAGGAGCAGGAGAAGGG - Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135340072 16:21637721-21637743 GAGAGGCACGGGCAGGAGCCGGG - Intronic
1135487834 16:22881407-22881429 CCGAGCAAGAAGCAGGACCCAGG - Intronic
1135660956 16:24296175-24296197 AGGAGGAAGGACCAGGAGTCGGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136534106 16:30889064-30889086 GAGAGGAGAGAGCAGGAACCTGG + Intronic
1136580861 16:31150009-31150031 AAGGGGGAGGAGCAGGTGCCGGG + Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137411806 16:48234919-48234941 CAGAGAAAGAATCAGGAACCTGG - Intronic
1137444770 16:48525017-48525039 CAGAGGGAGGGGCAGGAGTGGGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137783162 16:51114677-51114699 TAGAGGAAGCAGTAGGAACCCGG - Intergenic
1137938222 16:52656066-52656088 CACAGGGAGGAGCAGCAGCAGGG - Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138053684 16:53810480-53810502 AAAAGGAAGGAGGAGGAGCTAGG - Intronic
1138191006 16:55014186-55014208 CAGAGGAAGGAGTAGAAGATTGG + Intergenic
1138201714 16:55093438-55093460 CAGAGGGGTGGGCAGGAGCCAGG + Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139221286 16:65185087-65185109 CAGAGGCAGGATCTGAAGCCAGG + Intergenic
1139231089 16:65283257-65283279 CAGAGGATGCAGCTGGGGCCAGG + Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139392802 16:66615739-66615761 CAGGGGAAGGAGCCGGACACCGG + Exonic
1139642690 16:68304146-68304168 CTGAGGATGGACCAGGAGTCAGG - Exonic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1140339056 16:74139458-74139480 GATAGGCAGGTGCAGGAGCCAGG + Intergenic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140687279 16:77445534-77445556 CAGAGCAAGGAGGCAGAGCCAGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141202812 16:81910729-81910751 CTGAGGGTGGAGCAGGAGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141440936 16:84029179-84029201 CAGAGGAAGGGACAGGTCCCGGG + Intronic
1141457184 16:84151042-84151064 GAGAGGCGTGAGCAGGAGCCAGG + Intronic
1141651833 16:85396998-85397020 CAGAGCAAGGACCAAGAGACGGG + Intergenic
1141900400 16:86987036-86987058 CAGAGGAGGGGGCTGGGGCCAGG - Intergenic
1141930845 16:87201770-87201792 CACAGGCAGGGGCAGGAGCTTGG - Intronic
1142071232 16:88092188-88092210 AAGAGGAAGGAGCTGGGGCAGGG - Intronic
1142106242 16:88304414-88304436 CAGAGGAATCTGCAGGGGCCAGG + Intergenic
1142107775 16:88315564-88315586 CAGAGGAGGGAGCAGGGCCCAGG + Intergenic
1142215897 16:88829668-88829690 CAGAGGTGGGAGCAGGCGCCTGG - Intronic
1142717941 17:1757344-1757366 CAGGGGAAGAGGCAGCAGCCCGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1143863590 17:9908396-9908418 AGGAGGAAGGAGCTGGACCCAGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144761139 17:17708135-17708157 AGGAGGAAGGAGGAGGAGCAAGG - Intronic
1145178670 17:20725285-20725307 CAGAGGAAGTAGCAGTGTCCTGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145713270 17:26995341-26995363 CAGAGGCGGCAGCAGGAGCGGGG - Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1146063419 17:29618571-29618593 GAGGGGAGGGAACAGGAGCCGGG + Intronic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1146824707 17:36012468-36012490 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147119941 17:38330013-38330035 CAGAGGCAGGAGGATGACCCAGG - Exonic
1147368410 17:39974598-39974620 CAAAGGGAGGAGCAGTGGCCTGG - Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147614573 17:41820533-41820555 AAGAGGGAGGAGCAGGCGTCGGG - Intronic
1147615396 17:41824419-41824441 CATAGCTAGGAGCTGGAGCCAGG - Intergenic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147945437 17:44077806-44077828 AAGAGGAAGGAGGAGGAGAGGGG + Exonic
1147987427 17:44314693-44314715 CAGAGGATGCAGCAGGCCCCTGG - Intronic
1148208621 17:45794859-45794881 CAGAGGCAGGAGGCAGAGCCGGG - Intronic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148521057 17:48275339-48275361 CAGAGGTAGGAGGAGAACCCAGG - Intronic
1148563542 17:48619961-48619983 CCCAGGATGGGGCAGGAGCCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1148910939 17:50942402-50942424 CCCAGGAGGGAGCAGGAGCGTGG - Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149838311 17:59934857-59934879 CAGAGGAAGTAGCAGTGTCCTGG - Intronic
1150368337 17:64611848-64611870 CAGAGAGGTGAGCAGGAGCCAGG - Intronic
1150485036 17:65537534-65537556 CCGAGGAGGGGGCAGGCGCCCGG + Exonic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151161832 17:72172491-72172513 CAGAGACAGGAGCTGGTGCCTGG - Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151390608 17:73784477-73784499 CAGAGAAAGGAACTGGAGACAGG - Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151713514 17:75819836-75819858 CAGAGCAAGGGGCCTGAGCCAGG - Intronic
1151769041 17:76147682-76147704 CTGAGGAGGGAGCAGCAGCAGGG - Intronic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152534164 17:80940874-80940896 CAGAGGAAGAGGCAGGGTCCCGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1152942063 17:83178009-83178031 TAGTGGAATGAGCAGGAGCCGGG - Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153728226 18:7979958-7979980 CAGAGGCAGGAGCGAGAGCTGGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154198123 18:12280836-12280858 CACAGGAGGGAGTGGGAGCCAGG - Intergenic
1154201109 18:12301574-12301596 CTGAGGATGGAACAGGAGCGGGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1156481022 18:37436506-37436528 CAGAGGGGGGATCAAGAGCCAGG + Intronic
1157131201 18:45008991-45009013 CAGATGAACGAACAGGAGACTGG + Intronic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157173151 18:45426806-45426828 CAGAGGCAGAACCAGGAACCTGG - Intronic
1157261542 18:46179566-46179588 AAAAGTAAGGAGCAGGAGCAGGG + Intronic
1157322910 18:46647786-46647808 CAGAGGAAGCTGTAGAAGCCAGG - Intronic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157722973 18:49939608-49939630 CAGAGGTTGGAGCAGGATTCCGG - Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158404790 18:57151522-57151544 CAAAGGAAGGCGCAGGAGAGAGG + Intergenic
1159472988 18:68880354-68880376 GAGAGGCACGAGCAGGAACCGGG - Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161144598 19:2670271-2670293 CAGAGGAAGGAGCACCAGTGGGG + Intronic
1161273170 19:3401402-3401424 CAGAGGAGGGGGCAGAATCCAGG + Intronic
1161273538 19:3403673-3403695 AGGAGGAAGGCGCGGGAGCCCGG - Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161379802 19:3958951-3958973 GAGTGGGAGGAGCTGGAGCCAGG - Exonic
1161473193 19:4471597-4471619 TAGAGGAAGGGGCAGGCTCCGGG - Intergenic
1161504083 19:4634691-4634713 CAGAGGAGGCAGCACCAGCCTGG - Intergenic
1161572530 19:5038337-5038359 CAGAGGAGGGAACATGAGGCTGG + Intronic
1161678408 19:5666468-5666490 CAGAGCAAGGTGCAAGACCCTGG + Intronic
1161957949 19:7506691-7506713 CAGAGAAAGGGGGAGGAGCTTGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162178125 19:8846971-8846993 GACAGGCAGGTGCAGGAGCCGGG + Intergenic
1162534341 19:11254027-11254049 CAGATGAGGGAGCAGAGGCCAGG - Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162747153 19:12805221-12805243 CTGAGGAAGGGGCATGAGCCTGG + Intronic
1162793970 19:13077228-13077250 GAAAGGAGAGAGCAGGAGCCAGG - Intronic
1162958978 19:14114980-14115002 CAGGGGCAGGGGCAGTAGCCAGG - Intronic
1163085873 19:14979568-14979590 CGGATGCAGGAGCCGGAGCCCGG + Intronic
1163275162 19:16279049-16279071 TAGAGGAGGGAGCAGAGGCCGGG - Intergenic
1163764193 19:19153328-19153350 CAGAAGGAAGAGCAGGTGCCAGG + Intronic
1164061377 19:21678269-21678291 CACAGGATGGTGCAGGGGCCCGG + Intergenic
1164065278 19:21709443-21709465 CACAGGATGGTGCAGGGGCCTGG - Intergenic
1164130127 19:22354527-22354549 CAGAGGGAGGCTGAGGAGCCTGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164817888 19:31220230-31220252 AAGAGGAAGGAACAGGGGCCTGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165145371 19:33726936-33726958 GAGGGGAAGGTGCAGGAGCTGGG - Intronic
1165335950 19:35169733-35169755 CAGATGATGAAGCTGGAGCCAGG + Exonic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1165613043 19:37173419-37173441 CAGAGGAGGGAGGAGAAGTCCGG + Intronic
1165702711 19:37950702-37950724 CAGCGGAGGGAGCAGCAGACGGG - Intronic
1165737020 19:38183337-38183359 CAGACGAAGGGGCGGGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165797631 19:38528083-38528105 CAGAGCCAGGACCACGAGCCAGG - Intronic
1166243023 19:41506913-41506935 CAGAGGGAGGAGCAGCAGCAGGG - Intergenic
1166453439 19:42919930-42919952 CAGAAGAGGGAGCAGCAGCGTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166662742 19:44657803-44657825 CACAGGACGGATCAGGAGCTGGG - Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167112323 19:47469703-47469725 GAGAGGGAGAGGCAGGAGCCAGG - Intronic
1167120232 19:47512355-47512377 CAGAGGAAGCAGCGTGAACCAGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167259880 19:48452433-48452455 CAGAGGGAAGAGCAGGGGCGGGG + Intronic
1167394254 19:49217401-49217423 CAGAGGAACCAGCACTAGCCTGG + Intergenic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167453010 19:49583438-49583460 TGGAGGAAGGAGCAGGGGCTGGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167633065 19:50637853-50637875 CAGATGAAGGAACAGGAGTTAGG + Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168303377 19:55419685-55419707 CTGAGATGGGAGCAGGAGCCAGG - Intergenic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702013 1_KI270712v1_random:171745-171767 CCAAGGAGGGAACAGGAGCCTGG + Intergenic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925321842 2:2976381-2976403 CGGAGGGAAGAGCAGGAGTCTGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
927766116 2:25809887-25809909 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
927842899 2:26456749-26456771 CAGAGGTAGGGGCAAGGGCCTGG - Intergenic
927958393 2:27224206-27224228 CAGAGGGAGGACCAGAACCCAGG - Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928102756 2:28449090-28449112 CAGAGCCAGAAGCAGAAGCCAGG - Intergenic
928124349 2:28605535-28605557 CAGATGAAGGAGTGGGATCCTGG - Intronic
928452034 2:31386029-31386051 CAGAGCACCGAGCATGAGCCAGG - Intronic
928665577 2:33547838-33547860 GAGAGGAAGGAGGAGAAGCGGGG + Intronic
928902755 2:36338264-36338286 CAGAGCTATGAGCAGGAGTCAGG - Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
929245496 2:39697737-39697759 CAGAGGAAGCAGGAGAACCCTGG + Intronic
929533586 2:42767157-42767179 CAGAGGAATGGGCAGGAGCGGGG + Exonic
929583523 2:43099647-43099669 CAGAGGCAGGATCAGGACACAGG - Intergenic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
931205326 2:60140810-60140832 AAGAGGAGGGAGGAGGAGCGGGG - Intergenic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
931671717 2:64653829-64653851 CGGAGGAGGAAGCAGGAGGCGGG + Exonic
932164881 2:69497093-69497115 CAGAGGTAGGATCAGAAGCCAGG + Intronic
932220790 2:69997496-69997518 GGGAGGAAGGAGGAGAAGCCCGG - Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932323408 2:70838276-70838298 CATAGGAAGGGGCTGGAGCAGGG + Intergenic
932434594 2:71695541-71695563 AGGAGGGAGGAGCAGGAGCAGGG + Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933443771 2:82350253-82350275 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
933837309 2:86256418-86256440 CAGAGGCAGTGGCTGGAGCCTGG - Intronic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
933973513 2:87489458-87489480 CAGAGGCAGGAGCTGGGGCTGGG + Intergenic
934052079 2:88219539-88219561 CAGAGGCATGGGCAGCAGCCTGG + Intergenic
934172925 2:89555195-89555217 CCAAGGAGGGAACAGGAGCCTGG + Intergenic
934283239 2:91629552-91629574 CCAAGGAGGGAACAGGAGCCTGG + Intergenic
934898456 2:98139004-98139026 GAGAGGCACGAGCGGGAGCCGGG + Intronic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935053088 2:99540533-99540555 TAAAGAAAGGAGCAGCAGCCAGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935702570 2:105825086-105825108 GAGAGGAGGAGGCAGGAGCCAGG - Intronic
935818267 2:106868209-106868231 CAGGGGAAGGAACGGAAGCCTGG + Intronic
936320212 2:111460755-111460777 CAGAGGCAGGAGCTGGGGCTGGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936512219 2:113157503-113157525 GGGAGGCCGGAGCAGGAGCCCGG + Intronic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937209634 2:120260110-120260132 GAGAGGCACGAGCAGGAACCGGG - Intronic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937287495 2:120762511-120762533 CACAGGAAGGGGCAGGTCCCAGG + Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937883747 2:126886524-126886546 CTTAGGCAGGAGCAGGAGCGCGG - Intergenic
938082611 2:128378294-128378316 CAGAGGAGGACGCAGGGGCCAGG - Intergenic
938102415 2:128506135-128506157 CAGAGGAAGCACCAATAGCCAGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939320399 2:140612871-140612893 CGGAGGAAGGAGCAGAAGCATGG + Intronic
940013565 2:149080199-149080221 CATAGGAAGTACCAGAAGCCAGG - Intronic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940260984 2:151779516-151779538 TAGAGCAAGGAACAGGAGCGAGG - Intergenic
940268854 2:151869701-151869723 CAGAGGGATGAGCAGGAGAGTGG - Intronic
940377108 2:152969270-152969292 TTAAGGAAGTAGCAGGAGCCAGG - Intergenic
940856290 2:158730886-158730908 CAGGGGGAGGCCCAGGAGCCAGG - Intergenic
941035942 2:160569492-160569514 CACAGCAAGGAGCAGCAGCAGGG - Intergenic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942173382 2:173308655-173308677 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942227307 2:173828752-173828774 GAGAGGAAGGAGCTGGGGCGGGG - Intergenic
942299629 2:174548906-174548928 GAGAGGCAGGGGCAGGAACCGGG - Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944634107 2:201657841-201657863 GAGAGTAAGGAGCATGAGCAGGG - Intronic
944869636 2:203896934-203896956 CAGAGGAAGGAGCTTGAGAAAGG + Intergenic
945061794 2:205915805-205915827 TGGAGGAAGGGGCAGGAGCCAGG - Intergenic
946187845 2:217991181-217991203 CAGAGGAGGGAGGAGGGCCCAGG + Intronic
946358811 2:219206800-219206822 CCGAGGGAGGAGCGGGCGCCGGG + Exonic
946416866 2:219544117-219544139 AAGGGGAAGGCGCAGGAGCCGGG - Intronic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
946689327 2:222298782-222298804 CAGAGGCCGGAGCTGGAACCCGG + Exonic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946852608 2:223921749-223921771 CAAAGGAATGAGCAACAGCCAGG - Intronic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947488398 2:230573127-230573149 CAGAGGGAGGAGCAGCAGCAGGG + Intergenic
947502415 2:230681022-230681044 CTGAAGAACGAGCAGAAGCCAGG + Intergenic
947650354 2:231781183-231781205 CCGAGGATGGAGCCGCAGCCCGG + Exonic
947826957 2:233113084-233113106 ATGGGGAAGAAGCAGGAGCCAGG - Intronic
947882899 2:233535523-233535545 AAGAGGAAGGACCATGACCCAGG + Intronic
948062864 2:235054402-235054424 CCGAGGAGGGAGCAGGACCTGGG - Exonic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948618053 2:239214242-239214264 GAGAGAAGGGACCAGGAGCCAGG - Intronic
948650552 2:239440855-239440877 CCGAGGAGGGACCAGGAGACCGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948807155 2:240457940-240457962 GAGAGGTGGAAGCAGGAGCCTGG - Intronic
948840279 2:240645353-240645375 CTTAGGAAGGAGCCGTAGCCTGG + Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
949045614 2:241871510-241871532 CACAGGCAGGAGCAGGTGCTAGG + Intronic
949053405 2:241910118-241910140 CAGAGGGAGAACCAGGGGCCAGG - Intergenic
1169020351 20:2326398-2326420 CAGAGGAGGAAGCAGAGGCCCGG - Intronic
1169168824 20:3447501-3447523 CAGAGAAAGGAGCTGGGCCCAGG + Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170584696 20:17725556-17725578 CAGGTGAAGAAACAGGAGCCTGG + Intronic
1170714100 20:18817287-18817309 GAGATGGAGGGGCAGGAGCCTGG + Intronic
1170849332 20:19990140-19990162 CAGAGGAATCCGCAGGAGCTGGG + Exonic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171379571 20:24724205-24724227 CAGAGGAAACACCAGCAGCCTGG + Intergenic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171484356 20:25476663-25476685 CTGAGGAGGCGGCAGGAGCCGGG - Exonic
1172094621 20:32454599-32454621 CCGAGGCAGGGGCAGGAGACAGG - Intronic
1172310209 20:33912282-33912304 CAGAGGGAGGAGCAGTGGCAAGG + Intergenic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172528805 20:35616973-35616995 CAGAGGGCGGAGCTGGAGCCGGG + Intronic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1172766619 20:37354583-37354605 CAGGGGCAGGGGCAGGGGCCGGG + Intronic
1172781339 20:37438519-37438541 CAGAGCAGGGAGGAGGAGCGGGG + Intergenic
1173222319 20:41140183-41140205 CAGAGGATGTAGGAGGACCCTGG + Intronic
1173516224 20:43667221-43667243 CAGAGCCCGGAGCGGGAGCCGGG - Exonic
1173583153 20:44161471-44161493 CAGAGGCAGGATCTGGACCCAGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173637494 20:44573418-44573440 TAGATTAAGGATCAGGAGCCTGG + Intronic
1173656623 20:44704196-44704218 CAGGGGATGGTGGAGGAGCCTGG + Intergenic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174842360 20:53912196-53912218 CCGAGGAAAGAGCTGGAACCTGG - Intergenic
1174918670 20:54679424-54679446 GCGAGGAAGGAGCAGAGGCCTGG + Intergenic
1174997710 20:55589596-55589618 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175780200 20:61677194-61677216 TAGGGGAAGGAGCAGGGCCCTGG + Intronic
1175795406 20:61767511-61767533 CAGAGAGAGGGGCAGGAGCAGGG + Intronic
1175867083 20:62184625-62184647 TGGAGGCAGGAGCAGGAGGCCGG - Intronic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176090533 20:63316475-63316497 GGGAGGAAGGGGCAGGAGCGGGG - Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177501886 21:21967396-21967418 GACAGGAAGGAGCAGAACCCAGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178355320 21:31906526-31906548 CTGAGGCAGGAGCCTGAGCCCGG - Intronic
1178375664 21:32065570-32065592 ATGAGGAAGGACCACGAGCCTGG - Intergenic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178931114 21:36820132-36820154 CAAAGGAAGGGGCAGGGCCCAGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179606402 21:42518367-42518389 CAGAGAGAGGATCTGGAGCCAGG + Exonic
1179653548 21:42830964-42830986 CACAGGAAGGTGCTGGAGCCAGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG + Intronic
1180010930 21:45050707-45050729 CAGGGGACGGGGCGGGAGCCAGG + Intergenic
1180042329 21:45287193-45287215 CAGGGGCAGGGGCAGGGGCCGGG - Intronic
1180695073 22:17746771-17746793 CAGAGGCAGCCACAGGAGCCAGG + Intronic
1180800402 22:18629171-18629193 AAGAGGAAGCATCAGCAGCCAGG + Intergenic
1180851636 22:19024727-19024749 AAGAGGAAGCATCAGCAGCCAGG + Intergenic
1181023618 22:20115854-20115876 CAAAGGAGGGGTCAGGAGCCTGG - Intronic
1181039020 22:20183264-20183286 CACAGGAAGCATCATGAGCCAGG - Intergenic
1181221317 22:21366091-21366113 AAGAGGAAGCATCAGCAGCCAGG - Intergenic
1181410467 22:22714872-22714894 CGTAGGATGGAGCAGGAGCAGGG - Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181732839 22:24859936-24859958 CAGAGGAGGGGGCAGAAGCAGGG - Intronic
1181853625 22:25767399-25767421 CAGTGGAAGTAGCAGCAGCTCGG + Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182015934 22:27039680-27039702 GAGAGGAAAGAGGATGAGCCCGG + Intergenic
1182074045 22:27482846-27482868 GAGAGGAGGGTGCAAGAGCCAGG + Intergenic
1182881710 22:33739315-33739337 CAGGGGCAGGAACAGGAGACAGG - Intronic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183095430 22:35549147-35549169 CCGGGGCAGGGGCAGGAGCCTGG - Intronic
1183162343 22:36123338-36123360 GAGGGGAATGAGGAGGAGCCGGG + Intergenic
1183253736 22:36747431-36747453 GACATGAAGGAGCAGGAGTCAGG - Intergenic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183618115 22:38957166-38957188 CACAGGATGCAGCAGGTGCCAGG + Intronic
1183670172 22:39268239-39268261 CAGAGGAAGGAGCGTGGGCATGG - Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183740614 22:39666694-39666716 CACAGGGAGGAGCAGGCTCCAGG + Intronic
1184191622 22:42898761-42898783 CAGAGGAACGATTAGAAGCCTGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184305577 22:43599033-43599055 CAAATGTAGGAGCAGGTGCCTGG - Intronic
1184391358 22:44205338-44205360 CAGGGAAAGGAGCAAGGGCCTGG - Intronic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184552476 22:45211923-45211945 CAGACGCAGGGGCAGGGGCCGGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184865013 22:47197427-47197449 CCCAGGCAGGAGCAGGATCCCGG - Intergenic
1184965137 22:47966020-47966042 CTGGGGGAGGTGCAGGAGCCTGG - Intergenic
1185023341 22:48393342-48393364 CAGAGCCAGGATCTGGAGCCTGG + Intergenic
1185246948 22:49777768-49777790 GCGAGGAGCGAGCAGGAGCCGGG - Exonic
1185284385 22:49993865-49993887 AGGAGGCAGGAGCAGGAACCTGG + Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
950038844 3:9906638-9906660 CAGAGGCAGAAACAGAAGCCAGG + Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950173124 3:10852944-10852966 GAGTGGAATGAGCAGGAGCTGGG + Intronic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950187185 3:10952390-10952412 CAGAGGAAGGAGGGGGGTCCAGG + Intergenic
950528232 3:13537025-13537047 CAGTGGAGGAAGCAGGAGTCGGG + Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
952612396 3:35226606-35226628 CAGAGGAACGATCAGGCGGCAGG + Intergenic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
952963470 3:38607136-38607158 CAGAGGAAGAGACATGAGCCAGG - Intronic
953676606 3:45007590-45007612 CTGAGGAAGGTGCAGGGACCTGG + Intronic
954317965 3:49811548-49811570 CAGAAGAGGAAGCAGAAGCCTGG + Intronic
954333692 3:49904005-49904027 CAGGTGAAGGTACAGGAGCCAGG - Exonic
954712522 3:52512226-52512248 CAGAGCAAGGGGCAGGGGCTGGG + Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
954839847 3:53501011-53501033 CAGAGGCGGGAGCTGAAGCCTGG + Intronic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955496860 3:59542517-59542539 CTGAGGCATGAGGAGGAGCCAGG + Intergenic
955786947 3:62550931-62550953 AAGACTAAGGAGCAGCAGCCAGG - Intronic
955873163 3:63461331-63461353 CAGAGGGAGTAGGAGGAGCTGGG - Intronic
957179683 3:76860407-76860429 CAGAGCTAGAAGCAGAAGCCAGG + Intronic
957376767 3:79368684-79368706 GAGAGGAAGGAGCAGCAGCAGGG - Intronic
957404942 3:79765358-79765380 AAGAGGAAGCAGCAGCAGCTCGG - Intronic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
960149843 3:114238649-114238671 GAGAGGAAAGAGCGGGAACCCGG - Intergenic
960453862 3:117845295-117845317 CAGAGGAAGAAACTGTAGCCTGG - Intergenic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960937631 3:122913166-122913188 GAGAGGAAGGAGGGGGCGCCGGG + Intronic
960955387 3:123027468-123027490 CAGAGGCGGGTGCAGGTGCCCGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962324785 3:134423901-134423923 CAGAGAGGGGAGCAGGGGCCAGG - Intergenic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
963108358 3:141665387-141665409 CTGAGGTAGGAGCTTGAGCCTGG + Intergenic
963119408 3:141763558-141763580 CAGTGGAAGCTGCAGGATCCCGG + Intergenic
963123491 3:141795163-141795185 AAGAGGAAGGAGCATGCGCTAGG + Intronic
963533231 3:146497300-146497322 GAGAGGCACGGGCAGGAGCCAGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
964480398 3:157133349-157133371 AAGAGGAGGGGGCAGGTGCCAGG + Intergenic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
965077960 3:164002972-164002994 GAGAGGTGAGAGCAGGAGCCAGG + Intergenic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
965233850 3:166090411-166090433 CAGAGGAGGGATCTGGAGACAGG - Intergenic
965753271 3:171999230-171999252 CAGAGGCGTGAGCAGGAACCGGG - Intergenic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966662923 3:182434615-182434637 CAGAGTAGGGACTAGGAGCCAGG - Intergenic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967389665 3:188943223-188943245 CAGATCCAGGTGCAGGAGCCAGG - Intergenic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968165358 3:196460379-196460401 CAGAGGTAGCAGCAGCAGCTGGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968422792 4:499419-499441 CAGAGGAACGAACGGGAGCCGGG - Exonic
968661273 4:1799808-1799830 CACAGGTAGGAGCAGGGTCCAGG + Exonic
968741205 4:2332618-2332640 CACAGGAAGGAGCAGGTTCTGGG + Intronic
968952603 4:3702615-3702637 CAGAGGCAGATGCAGGAGCGGGG - Intergenic
969288397 4:6222414-6222436 CAGAGGCAGGCTCCGGAGCCCGG - Intergenic
969411257 4:7029867-7029889 CAGAGGAGGGAGCAGGCTCTGGG + Intronic
969512274 4:7625563-7625585 AGGAGGTAGGTGCAGGAGCCGGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
969826774 4:9764051-9764073 CCGAGGAGGGAACAGGAGCCTGG + Intergenic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972352668 4:38251465-38251487 CAGAGGAAGGATTATGAGCAGGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972401167 4:38705131-38705153 CAGAGGTAGGAGCAGAACTCAGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972774180 4:42226334-42226356 CAGAGGCAGCAGCCGGAGTCAGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973614451 4:52664657-52664679 CAGAGGAAGGCACATGATCCAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
975619723 4:76284111-76284133 AAGAGAGAGGAGGAGGAGCCAGG - Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976096637 4:81515341-81515363 CAGAGGGGAGGGCAGGAGCCAGG + Intronic
976123345 4:81806648-81806670 CAGAGGAAGAACCAGTGGCCTGG + Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
976980336 4:91218328-91218350 GAGAGGCACGAGCAGGAACCGGG - Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977906450 4:102483138-102483160 GAGAGGCACGAGCAGGAACCAGG + Intergenic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981637502 4:146897680-146897702 CAGAGGCAGGAGCAATAGCAGGG - Intronic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
982325770 4:154126999-154127021 GACAGGCAGGAGCAGGAGCCAGG + Intergenic
982918418 4:161244354-161244376 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
984140742 4:176001781-176001803 CAGAGGAAGGTGCTGGTGCAGGG - Intronic
984235516 4:177152847-177152869 AAGAGAGAGGAGCAGGTGCCAGG - Intergenic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985380158 4:189385295-189385317 CTGTGGAATGACCAGGAGCCAGG + Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985539726 5:482307-482329 CAGAGGAGGAAGCAGCACCCGGG + Intronic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985648509 5:1096620-1096642 AAGATGAAGGACCAGGAGCCTGG + Intronic
985670068 5:1202406-1202428 CAGAGGAACGAGGAGCAGTCAGG - Intronic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
986004288 5:3655014-3655036 CAGAGACAGGAGCAGAAGCAGGG - Intergenic
986251236 5:6060304-6060326 AATAGGAAGCAGGAGGAGCCTGG + Intergenic
986323359 5:6652118-6652140 CAGAGAAAGCAGCAGCACCCCGG + Intronic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
986788147 5:11134124-11134146 CTGAGGAGGGAGCAGGAGAAAGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987038220 5:14038601-14038623 CAGAGGCAGGATGAGGACCCAGG + Intergenic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
987122933 5:14784635-14784657 CAGAGTAAGGAGCAGGGTCATGG + Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
991082289 5:62614612-62614634 GACAGGTAGGTGCAGGAGCCAGG + Intronic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
993015814 5:82533291-82533313 CACATGAAGGAGCATGAGCATGG + Intergenic
993911375 5:93689065-93689087 TAGAGAAATAAGCAGGAGCCAGG - Intronic
994387294 5:99147000-99147022 CAGAGGAAGAATCAGGAATCAGG + Intergenic
994507071 5:100656765-100656787 GAGAGGCAGGAGCGGGATCCGGG + Intergenic
995054630 5:107745547-107745569 GAGAGGAACTGGCAGGAGCCAGG + Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996818193 5:127596700-127596722 CAGAGGTCGCAGCAGGAGACCGG + Intergenic
996993571 5:129667271-129667293 CAGAGAAAAGATCAGGACCCAGG - Intronic
997496370 5:134330339-134330361 GAGAGGAATGAGCTGGAGCATGG + Intronic
997733727 5:136198680-136198702 TAGAGGAAGGGGCGGGTGCCAGG + Intergenic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998099468 5:139419972-139419994 GAGAGGAGGGATCAGGAGGCTGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998295656 5:140966828-140966850 GAGAGGCAGTAGCAGCAGCCAGG - Exonic
998430542 5:142066178-142066200 CAGGGGCAGCAGCAGAAGCCAGG + Intergenic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
999311598 5:150555186-150555208 CGGAGGAAGGGACAGGAACCTGG - Exonic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999409295 5:151336366-151336388 CTGAGGGAAGAACAGGAGCCAGG - Intronic
999836392 5:155377791-155377813 CAGAGGTACAAGGAGGAGCCGGG - Intergenic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000278745 5:159763872-159763894 CAGGTGAAGTAGCAGGGGCCAGG - Intergenic
1000949375 5:167462275-167462297 GACAGGTAGGTGCAGGAGCCAGG + Intronic
1001042978 5:168350004-168350026 CAGAGGAATGACCTGGAGCTGGG - Intronic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001156688 5:169278607-169278629 CAGAGGAAGTAGCAGAAGCAGGG - Intronic
1001628089 5:173153602-173153624 CAGTGGAAGGAGCAGCTCCCTGG + Intronic
1001703742 5:173726480-173726502 AAGTGGAAGGATCATGAGCCTGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001786639 5:174419255-174419277 CAGAGGCAGGACCAGGGTCCTGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002000687 5:176194872-176194894 CAGGGGCAGGGGCAGGAGCGGGG + Intergenic
1002181826 5:177434701-177434723 CAGAGGAAGGATCTAGAGCCAGG - Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002253655 5:177944115-177944137 CAGGGGCAGGGGCAGGAGCGGGG - Intergenic
1002419715 5:179139289-179139311 CTGAGGAGGGAGCACGGGCCCGG + Intronic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1002569050 5:180129731-180129753 CAGTGGTGGGAGCTGGAGCCTGG - Intronic
1002584052 5:180230301-180230323 CAGAGGAAGGTTCAGGAGACAGG + Intergenic
1002717189 5:181234908-181234930 TAGAGGGAGAAGCAGGGGCCTGG - Exonic
1002755564 6:156369-156391 CAAACGAAAGAGCAGGATCCTGG + Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1003274722 6:4639698-4639720 TATAGGGAGGAGCAGGGGCCAGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003990270 6:11479976-11479998 CAGATTAAGAAGCAGTAGCCAGG + Intergenic
1004169341 6:13283787-13283809 CAGGAGGAGGAGCAGCAGCCTGG + Intronic
1004184792 6:13412704-13412726 AAGAGGAGGGAGCAGAAGGCAGG - Intronic
1004346895 6:14857239-14857261 CACAGCAAGGAGCAAGAGCGAGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1005720572 6:28597723-28597745 CAGAGGAGCTAGCTGGAGCCAGG - Intronic
1005916631 6:30357838-30357860 CAGAGGAAGGCGGAGGGGCGAGG - Intergenic
1005965345 6:30722641-30722663 CACAGGTAAGGGCAGGAGCCCGG + Exonic
1006088643 6:31615124-31615146 CCCAGGAAGGAGGGGGAGCCTGG - Intergenic
1006174014 6:32110921-32110943 CAGAGGAAGGAAGCTGAGCCTGG - Intronic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006230372 6:32581267-32581289 CAGAGGCAGGGCCTGGAGCCTGG + Intronic
1006302982 6:33203906-33203928 CAAAGGAAGGAACTGTAGCCTGG + Exonic
1006316977 6:33297181-33297203 CAGAGGGAGGAGCAGGGCCTGGG - Intronic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006434909 6:34021010-34021032 CATAGGCAGCAGCTGGAGCCTGG - Intronic
1006581696 6:35081185-35081207 CAGAGGAATGAGGTAGAGCCTGG - Intronic
1006732045 6:36243578-36243600 CTGAGGAAGGAGGTGCAGCCTGG + Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1007090113 6:39178866-39178888 GAGAGGAAGAGACAGGAGCCAGG - Intergenic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008920807 6:56843245-56843267 AAGAGGAAGGAGCAGCACGCTGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011179077 6:84598851-84598873 CATAACAAGGAGCAGGAGCTGGG - Intergenic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1012288821 6:97425508-97425530 CAAAGGGAAGAGCAGGTGCCAGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012718962 6:102716564-102716586 GATAGGAGGGAGCTGGAGCCTGG + Intergenic
1013215069 6:108019670-108019692 AAGAGAAAGAGGCAGGAGCCAGG + Intergenic
1013258074 6:108409442-108409464 GGGAGGAAGGAGCAGGAGCGGGG + Intronic
1013290731 6:108717030-108717052 CAGAGGAAGGGGTAGCGGCCAGG + Intergenic
1013317956 6:108959629-108959651 CAGAGAAAGAATCACGAGCCCGG - Intronic
1013328760 6:109075938-109075960 CAAAGGGAGGAGCAGGGTCCAGG - Intronic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013932931 6:115556627-115556649 GAGATGAAGGAGCATGTGCCAGG - Intergenic
1014910969 6:127092417-127092439 CATAGGAAGGAACAGATGCCAGG - Intergenic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1018101722 6:160446265-160446287 CAGAGGCAGGACCTGGAGCATGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018811249 6:167299976-167299998 CAGAGGAGGGAGCAGGTACGGGG + Intronic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1018979575 6:168592339-168592361 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979585 6:168592390-168592412 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979593 6:168592441-168592463 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979615 6:168592546-168592568 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979645 6:168592702-168592724 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979664 6:168592804-168592826 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979674 6:168592855-168592877 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979685 6:168592906-168592928 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979696 6:168592957-168592979 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979715 6:168593059-168593081 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979725 6:168593110-168593132 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979736 6:168593161-168593183 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979746 6:168593212-168593234 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979755 6:168593263-168593285 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979766 6:168593314-168593336 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979776 6:168593365-168593387 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979786 6:168593416-168593438 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979797 6:168593467-168593489 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979807 6:168593518-168593540 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979817 6:168593569-168593591 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979828 6:168593620-168593642 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979838 6:168593671-168593693 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979848 6:168593722-168593744 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979858 6:168593773-168593795 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979869 6:168593824-168593846 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979879 6:168593875-168593897 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979890 6:168593926-168593948 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979900 6:168593977-168593999 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979911 6:168594028-168594050 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979921 6:168594079-168594101 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979942 6:168594184-168594206 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979952 6:168594235-168594257 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979962 6:168594286-168594308 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979973 6:168594340-168594362 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018979994 6:168594445-168594467 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980004 6:168594496-168594518 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980023 6:168594598-168594620 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980032 6:168594649-168594671 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980042 6:168594700-168594722 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980052 6:168594751-168594773 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980062 6:168594802-168594824 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980073 6:168594856-168594878 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980083 6:168594907-168594929 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980094 6:168594961-168594983 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980104 6:168595012-168595034 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980113 6:168595063-168595085 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980134 6:168595165-168595187 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1018980145 6:168595219-168595241 CTCAGGAAGGAGGAGGAGCTCGG - Intronic
1019060303 6:169252642-169252664 CACAGGAAGGATGAGCAGCCAGG + Intronic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019190394 6:170247515-170247537 CATGGGAAGGAGCAGCCGCCGGG - Intergenic
1019284625 7:217326-217348 TAGAGAAAGCAACAGGAGCCAGG - Intronic
1019493734 7:1326652-1326674 CAGAGGCAGCAGCAGGCTCCAGG - Intergenic
1019519853 7:1455655-1455677 CAGAGGCAGAACCAGGAGCCCGG + Intronic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1021819348 7:24480709-24480731 CAGAGGCAAGGGCAGGAGCTGGG - Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022081341 7:27024925-27024947 CAAAGGGAGGAGCAGCAGCAGGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022247406 7:28573555-28573577 AAGAGGGGGGAGCAGGAGCCAGG - Intronic
1022321486 7:29292150-29292172 CAGAGGATGGAGCGAGAGACGGG + Intronic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023815060 7:43943311-43943333 CAGAGAAGGGAGCCAGAGCCTGG - Intronic
1024031195 7:45461177-45461199 CTGAGGTAGGAGCGGGAGACAGG - Intergenic
1024252900 7:47519773-47519795 CAGAGGATGGAGTCGAAGCCTGG - Intronic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026493714 7:70884970-70884992 GAGAGGAAGGAGCTGGAGAGAGG + Intergenic
1028503881 7:91550181-91550203 GAGAGGAAGCAGCAGGGGCTAGG - Intergenic
1028826648 7:95281357-95281379 GACAGGAAGGAGGAAGAGCCAGG - Intronic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1028984908 7:97002134-97002156 GAGACAAAGAAGCAGGAGCCAGG + Intergenic
1028999643 7:97139515-97139537 CAGAGGAAAGAGCACCAGACAGG + Intronic
1029008028 7:97230576-97230598 CACAGGCAGGTGCAGGAACCAGG - Intergenic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1029380123 7:100208546-100208568 CAGAGGAAGGAGGAGCATCATGG + Intronic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029617006 7:101665404-101665426 CAGAGGAAGAGACAGGGGCCGGG - Intergenic
1031053789 7:116972128-116972150 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032088052 7:128893926-128893948 CAGAGGCAGGCCCCGGAGCCAGG + Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032268239 7:130383135-130383157 CAGGGGAAGGGCCAGGGGCCTGG + Intronic
1032718015 7:134527530-134527552 CAGTGGGAGGAGTTGGAGCCTGG - Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1032848662 7:135773522-135773544 CAGAGGAGGAGGGAGGAGCCAGG - Intergenic
1032945694 7:136849748-136849770 CAGGGGAAGGAGGAGAAGACAGG + Intergenic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033359010 7:140624536-140624558 CAGAGGTAGAAGCAGAACCCAGG + Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034038371 7:147848988-147849010 CAGAGTACGTAGCTGGAGCCTGG - Intronic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034219025 7:149430283-149430305 CAGAGGAGGGAGCAGAGGTCTGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034262189 7:149764151-149764173 CCGAGCTAGAAGCAGGAGCCAGG + Intergenic
1034278112 7:149832934-149832956 GAGGGGACGGGGCAGGAGCCTGG + Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034455507 7:151167833-151167855 CTGCGGAGGGAGCGGGAGCCGGG - Intronic
1034845781 7:154443141-154443163 CAGAGGGAGTGGCAGGTGCCTGG - Intronic
1034881762 7:154768066-154768088 CTGGGGTGGGAGCAGGAGCCAGG - Intronic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1034907903 7:154966850-154966872 CAGGGGTTGGGGCAGGAGCCAGG - Intronic
1034959933 7:155358830-155358852 CAGGGGCTGGGGCAGGAGCCCGG - Intronic
1035151223 7:156874362-156874384 GAGAGGCACGAGCGGGAGCCGGG - Intronic
1035272499 7:157728664-157728686 CAAAGGAAGGAGCCGCAGACAGG - Intronic
1035316112 7:157998330-157998352 CAGAGCCAGGAGCAGCAGTCAGG + Intronic
1035370403 7:158376150-158376172 GATAGGCAGGTGCAGGAGCCGGG - Intronic
1035472342 7:159118487-159118509 AAGAGGCAGGATCAGGAGGCAGG - Intronic
1035677174 8:1463977-1463999 CTGAGGAAGGAGCTGAAACCTGG + Intergenic
1035698093 8:1615343-1615365 TGGAGGAGGGAGCAGGTGCCGGG + Intronic
1035927130 8:3740578-3740600 CACAGGAAGGAGGACGAGCAGGG + Intronic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036419960 8:8586295-8586317 CAGCTGGAGGCGCAGGAGCCAGG - Intergenic
1036445998 8:8822397-8822419 CAGGGGATGGAGCGGGAGACAGG + Intronic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036503640 8:9335809-9335831 CAGAGGTAGGACCAGAAGCCAGG + Intergenic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037670766 8:21013348-21013370 CAGAGGAGGGAGGAGAAGCTGGG + Intergenic
1037784141 8:21892669-21892691 CAGAGGGAGGACCAGAAACCTGG - Intergenic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037858363 8:22387759-22387781 CAAAGGAAGCAGGAGGAACCTGG - Intronic
1037922672 8:22818524-22818546 CAGGGGAGGGAGCAGAGGCCAGG + Intronic
1038378896 8:27073652-27073674 CAGTGGAAAGAGCAGGAACTTGG + Intergenic
1038638241 8:29304255-29304277 GAGAGGCACGAGCAGGAACCGGG + Intergenic
1038911296 8:31967635-31967657 GTGAGGAAGGAACAGGAACCAGG + Intronic
1039256066 8:35720228-35720250 AATAGGAAGGACCAGAAGCCAGG - Intronic
1039418600 8:37417357-37417379 CAAAGGAAAGATCAGGAGCTTGG - Intergenic
1039466153 8:37786800-37786822 CCGAGCAAGGTGGAGGAGCCGGG + Intronic
1039659592 8:39448091-39448113 GACAGGGAGGTGCAGGAGCCAGG - Intergenic
1039793367 8:40892644-40892666 CAGAGGGAGGACCAGAATCCAGG - Intronic
1039802718 8:40973938-40973960 CAGAGGGAGGACCAGGAGTTTGG - Intergenic
1039885820 8:41653597-41653619 GAGAGGAAGGTGCAGGATCGAGG + Intronic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041712444 8:60906643-60906665 CTAGGGAAGGAGCAGAAGCCAGG + Intergenic
1041795544 8:61743682-61743704 AACAGGAAGGAGCATGTGCCTGG + Intergenic
1041957690 8:63574414-63574436 CAGAGGAAGGAAGAGGAGTTGGG - Intergenic
1042440402 8:68819794-68819816 TAGAGGAAGGATGAGGAGCTAGG + Intergenic
1042601398 8:70502912-70502934 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1043034448 8:75178758-75178780 TAGAGGCATGAGCGGGAGCCGGG - Intergenic
1044533964 8:93338783-93338805 TGGTGCAAGGAGCAGGAGCCAGG - Intergenic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1044941322 8:97347188-97347210 GAGAGGGAGGAGGAGGATCCAGG + Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045906591 8:107353434-107353456 CAAAGCAAGTAGCAGGAACCAGG - Intronic
1046582566 8:116111148-116111170 GACAGGCAGGTGCAGGAGCCAGG - Intergenic
1047357904 8:124140760-124140782 CACAGGAAGGAGGAAGGGCCAGG + Intergenic
1047408778 8:124607174-124607196 AAGAGGGATGAGGAGGAGCCAGG - Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048837554 8:138535979-138536001 AAGAGGAAGGGGCAGGGGCGTGG - Intergenic
1048906707 8:139095946-139095968 TAGAGGAAGGAAGAGGAACCAGG - Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049337895 8:142096220-142096242 CAGAGCAGTGAGGAGGAGCCAGG - Intergenic
1049343827 8:142128037-142128059 CACAGGAAGGAGGAGCAGCCTGG - Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049439259 8:142601770-142601792 CAGACGAACTAGCAGGAGCCCGG + Intergenic
1049620496 8:143596288-143596310 CAGAGGCAGGTCTAGGAGCCTGG + Intronic
1049774060 8:144396649-144396671 CAGAGGAGGGGGCTGGGGCCCGG - Exonic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050040928 9:1492652-1492674 CAGAGGGAGGAGGATGAGCTAGG + Intergenic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1050474342 9:6024194-6024216 CAGAGGTACCAGCAGTAGCCTGG + Intergenic
1051383263 9:16480510-16480532 GAGAGGCGGGAGCAGGAACCGGG + Intronic
1051544947 9:18263401-18263423 CGGAGGAAGCAACAGGAGCCAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053484471 9:38441738-38441760 CAGAGGTATGGGCAGGAGCTGGG + Intergenic
1054519751 9:66065919-66065941 CCAAGGTCGGAGCAGGAGCCGGG + Intergenic
1055457555 9:76487216-76487238 CAAGGGAAGGAGCAGGAAACAGG - Intronic
1055560044 9:77513636-77513658 GAGAGGAAGGGGCAGAGGCCAGG - Intronic
1056261884 9:84857002-84857024 CAGAGGAAGGAGCTGGGAACAGG - Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057168381 9:92945886-92945908 CAGAGCAATGAGCGGGAGCTGGG + Intergenic
1057200699 9:93138252-93138274 AACAGGCAGGAGCAGGAGGCTGG + Intergenic
1057442942 9:95095255-95095277 CAGAGGAAGGGACAGGAAACTGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058176034 9:101737729-101737751 CAGAGGGATGAGCCGGAGCCAGG - Exonic
1058525964 9:105857999-105858021 GAGAGGAGGGAGCAAAAGCCAGG - Intergenic
1058832558 9:108832195-108832217 CAGAGGTAGGAGTGGGAGCTGGG - Intergenic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1059426976 9:114227400-114227422 CAGAGGCAGGACCAGAACCCAGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1060053435 9:120392984-120393006 GAGAGGGAGAAGCAGGAACCAGG - Intronic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060771260 9:126333772-126333794 AAGAGGAAGGAGGGGGAGACTGG + Intronic
1060804160 9:126564320-126564342 CAGAGCAGGGAGCAGCAACCAGG + Intergenic
1061034981 9:128108384-128108406 AAGACGAGGGAGCAGGAGCTTGG + Exonic
1061089787 9:128420380-128420402 CGGAGGATGGGGCGGGAGCCGGG + Intronic
1061589848 9:131591283-131591305 CACAGGAAGGAGCGGGGGCGCGG + Intronic
1061799337 9:133105534-133105556 CAGAGGTAGCGTCAGGAGCCTGG + Intronic
1061889599 9:133610901-133610923 AAGAGGAAGGAGGACTAGCCTGG - Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062185148 9:135214266-135214288 CAGAGGAAGGTGCTGGTGCAGGG + Intergenic
1062192740 9:135256131-135256153 CAGAGAAAGGCCCAGGACCCAGG - Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185494554 X:544530-544552 CAGAGGCTGGAGCAGGTGACTGG + Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186005755 X:5070181-5070203 CTCAGGAAGGATCTGGAGCCTGG + Intergenic
1186280951 X:7992518-7992540 CAGAGGACAGAGCTGGAACCAGG - Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186875886 X:13817257-13817279 GAGAGCAAGGAGGAAGAGCCCGG - Exonic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187785761 X:22884131-22884153 CAGAGCAAGGATCAGCAACCTGG - Intergenic
1188473906 X:30569643-30569665 AGGAGGAAGGAGCAGCAGCAAGG + Intronic
1189269365 X:39740137-39740159 CAGAGGAAGAGGCAGGGGCCCGG - Intergenic
1189322142 X:40093403-40093425 AAGAGGAGGGAGGAGGAGACTGG + Intronic
1190049047 X:47135765-47135787 CAGTTGAAGGCGCAGGACCCAGG - Intergenic
1190385782 X:49881007-49881029 CAGAAGGAGGTGCAAGAGCCAGG - Exonic
1190407014 X:50098361-50098383 CAGAGGTAAGAACAGGAGGCTGG - Exonic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190753707 X:53382815-53382837 CAGAGCAAGAAACAGGGGCCTGG + Intronic
1191157835 X:57295108-57295130 CTGAGGTAGAAGCAGCAGCCAGG - Intronic
1191618676 X:63192929-63192951 GAGAGGCAGGAGCGGGAACCTGG - Intergenic
1192141133 X:68647821-68647843 GAGAGGGAGGAGCCGGTGCCCGG + Exonic
1192179879 X:68909797-68909819 TAGAGGACAGAGCAGGAGCTGGG - Intergenic
1192193673 X:69014782-69014804 CAGAGCTAGGACCAGGACCCAGG - Intergenic
1192204982 X:69089613-69089635 CCCAGGAAGCAGCAGCAGCCTGG + Intergenic
1192261935 X:69510752-69510774 TCTGGGAAGGAGCAGGAGCCAGG + Intronic
1192511146 X:71721057-71721079 AAGAGGAGGGAGCATGAGCAGGG - Intergenic
1192515551 X:71760496-71760518 AAGAGGAGGGAGCATGAGCAGGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192631025 X:72777830-72777852 CAGAGTAATCATCAGGAGCCGGG - Intronic
1192650684 X:72942971-72942993 CAGAGTAATCATCAGGAGCCGGG + Intronic
1193235028 X:79096247-79096269 TAGAGGAAAGAGCACTAGCCTGG + Intergenic
1193792694 X:85835024-85835046 AAGAGGGAGGAGGAGGAGCAAGG - Intergenic
1193793065 X:85840521-85840543 CAGAGCCAGGATTAGGAGCCAGG - Intergenic
1193979817 X:88168716-88168738 CAGAGGAAAAAGCAGAAGCCTGG - Intergenic
1194763014 X:97816697-97816719 GACAGGCAGGTGCAGGAGCCAGG + Intergenic
1195310958 X:103631309-103631331 CAGTGGAAGGATCAGGACCCAGG - Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196799934 X:119533319-119533341 CAGAGGAGTGAGCAGAAACCAGG - Intergenic
1196846337 X:119899449-119899471 CAGAGGAAGGTGCAGCTCCCCGG + Intronic
1198023681 X:132683779-132683801 CAGAGCAAGTAGCATGGGCCAGG + Intronic
1198147087 X:133868249-133868271 GACAGGCAGGAGCAGGAGCTAGG - Intronic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1198496229 X:137196298-137196320 GAGGGGCAGGAGCAGCAGCCAGG - Intergenic
1199028840 X:142972496-142972518 GAGAGGCACGAGCAGGAACCGGG - Intergenic
1199188069 X:144939737-144939759 CTGAGATTGGAGCAGGAGCCGGG + Intergenic
1200003612 X:153074081-153074103 CACAGGAAGGGGCCGGTGCCCGG + Exonic
1200004111 X:153075928-153075950 CACAGGAAGGGGCCGGTGCCCGG - Intergenic
1200076096 X:153551953-153551975 CACAGGAAGGAGCGTGGGCCTGG - Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200425089 Y:3011646-3011668 AGGAGGAAGGAGCAGGAGAGAGG - Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201694730 Y:16812232-16812254 CACAGGCAGGTGCAGGAGCTTGG - Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic