ID: 1034357751

View in Genome Browser
Species Human (GRCh38)
Location 7:150466067-150466089
Sequence CTCGTGATGCACCCAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034357751 Original CRISPR CTCGTGATGCACCCAGTGCC AGG (reversed) Intronic
902575386 1:17374129-17374151 CTCCAGGTGCACCCAGTGCGGGG + Intronic
906135251 1:43495263-43495285 CTCCTGCTGTTCCCAGTGCCTGG - Intergenic
906568571 1:46817748-46817770 CAGGTGCTGTACCCAGTGCCGGG + Intronic
907114441 1:51956626-51956648 CTCATGCTGCACCCTCTGCCTGG + Intronic
915721157 1:157986701-157986723 CACGTGCTTCACCCAGTGCCTGG + Intergenic
917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG + Intronic
917212995 1:172648929-172648951 CTTGAGATGCTCCCATTGCCTGG - Intergenic
923915660 1:238500945-238500967 CTAGTGAAGCACCCTGTGCCTGG + Intergenic
1065810519 10:29438721-29438743 ATCATGACCCACCCAGTGCCAGG - Intergenic
1068714751 10:60175959-60175981 CTCGTGCTGAAAACAGTGCCTGG + Intronic
1075515071 10:123102156-123102178 CGGGTCATGCACCCAGTGCCAGG + Intergenic
1077114043 11:875102-875124 ATGGTGAGGCCCCCAGTGCCAGG + Intronic
1077196077 11:1280837-1280859 CTCGGGCTGCAGCCACTGCCAGG - Intronic
1079470970 11:20777030-20777052 ACCATGATACACCCAGTGCCTGG - Intronic
1091207147 11:133829723-133829745 CTTGGGAACCACCCAGTGCCTGG - Intergenic
1091223819 11:133946165-133946187 GACGTGATCCACCCAGTGACGGG - Exonic
1093497560 12:19775582-19775604 CTCGAGATGGACTCAGTTCCAGG + Intergenic
1095133716 12:38572491-38572513 CTCTGGATTCACCCAGGGCCTGG + Intergenic
1101879456 12:108616586-108616608 CCCATGATGCTCCCACTGCCTGG + Intergenic
1101914293 12:108884422-108884444 CTTGTGAAGCACTTAGTGCCGGG + Intronic
1103264816 12:119620069-119620091 CTCATGACCCACACAGTGCCTGG - Intronic
1103484427 12:121273505-121273527 CAAGTGCTGAACCCAGTGCCTGG + Intronic
1103718745 12:122962155-122962177 GTCCTGAGGGACCCAGTGCCGGG - Intronic
1104214545 12:126723353-126723375 CCTGTGATGCACACTGTGCCCGG + Intergenic
1104652393 12:130545211-130545233 CTCGAGATGTACCAAGTACCAGG - Intronic
1108739099 13:53316708-53316730 CTCATTATGAACACAGTGCCAGG + Intergenic
1111583383 13:90253260-90253282 CTCCTGAAACACCCAGTTCCAGG - Intergenic
1112437294 13:99399515-99399537 CTGGGGATGGACTCAGTGCCTGG - Intergenic
1112483643 13:99800368-99800390 CTGCTGCTGCAACCAGTGCCTGG + Intronic
1118322781 14:64763169-64763191 CTTCTGAGGCACCCAGAGCCTGG + Intronic
1119480038 14:74953375-74953397 CTCTTGATGCAACCAGGGCGGGG + Intronic
1121333100 14:93060220-93060242 CTGGTGAGGCACCTAGAGCCTGG - Intronic
1123490191 15:20774687-20774709 TTTGTGCTGCACCCAGTGACAGG + Intergenic
1123546692 15:21343774-21343796 TTTGTGCTGCACCCAGTGACAGG + Intergenic
1123976055 15:25555706-25555728 CTCATGGTGCACCCTCTGCCCGG - Intergenic
1126935054 15:53697556-53697578 TTCCTGATGCTGCCAGTGCCTGG + Intronic
1128296931 15:66529801-66529823 CATGTAATGCACCTAGTGCCTGG + Intronic
1128889615 15:71318889-71318911 ATCGTACTGCACCCAGGGCCAGG - Intronic
1132151732 15:99467086-99467108 CTCCTGGTGCAGACAGTGCCGGG + Intergenic
1202955023 15_KI270727v1_random:70989-71011 TTTGTGCTGCACCCAGTGACAGG + Intergenic
1132501520 16:286558-286580 CCCGTGGTGCACCCACTGCAAGG + Exonic
1132761771 16:1512002-1512024 GTCCTGATGCAACCAGGGCCTGG + Intronic
1135814737 16:25622274-25622296 CTAGTGTTGAACCCAGTACCTGG + Intergenic
1138482120 16:57310527-57310549 CTCACGATGCACACAGGGCCAGG - Intergenic
1139472016 16:67183545-67183567 TTCATTATGCACCCAGTGCTGGG - Exonic
1142173536 16:88634800-88634822 CTCGCGGTGCAGCCTGTGCCTGG + Intergenic
1142486521 17:251076-251098 CTCCTTATGCTCACAGTGCCAGG + Intronic
1143579752 17:7818627-7818649 GTCCTGATGCCCCCAGGGCCTGG + Exonic
1147131217 17:38410424-38410446 CTCATGGTTCACCCTGTGCCTGG + Intergenic
1148919297 17:51016225-51016247 CTTGTCATGCACCCTTTGCCAGG + Intronic
1151554880 17:74841766-74841788 CACGTGTTACATCCAGTGCCAGG + Intergenic
1152745529 17:82037007-82037029 CCCCTGATACACACAGTGCCCGG - Exonic
1152926835 17:83091210-83091232 CTCGAGGCGCCCCCAGTGCCAGG + Intronic
1153227438 18:2909339-2909361 ATGATGATGCACCCACTGCCTGG + Intronic
1160509213 18:79443918-79443940 CTCATGATGCCAACAGTGCCAGG + Intronic
1161148734 19:2695439-2695461 CACGTGGTGCTCCCAGGGCCTGG + Intronic
925193553 2:1905029-1905051 CTCGTGATCCACCCACCGCCTGG + Intronic
925922949 2:8650312-8650334 ATCTTAAGGCACCCAGTGCCTGG - Intergenic
934753760 2:96810968-96810990 CTCCTGCTGCACCCAGTGGAAGG - Exonic
937100782 2:119266326-119266348 CTCGTGAAGCACAAAGTGCAAGG - Intergenic
946908043 2:224434785-224434807 CTCAGGACCCACCCAGTGCCTGG - Intergenic
948283599 2:236767807-236767829 CTGGAGAAGCACCCAGTGACAGG - Intergenic
1169804076 20:9541567-9541589 CACTTGATGCTCCCCGTGCCTGG + Intronic
1172151103 20:32791034-32791056 CTCCTGATGTACCAAGTCCCTGG - Intronic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1177190073 21:17840997-17841019 CTCCTGGTGCACCCATTCCCAGG - Intergenic
1180995244 22:19962249-19962271 CTGGGGAAGCACCCAGGGCCAGG + Intronic
1184748994 22:46473455-46473477 CTGGAGACGCAGCCAGTGCCGGG + Intronic
1184855574 22:47144707-47144729 CACGGGCTGCACCCAGTCCCAGG - Intronic
1184855584 22:47144751-47144773 CACGGGCTGCACCCAGTCCCAGG - Intronic
1184855594 22:47144795-47144817 CACGGGCTGCACCCAGTCCCAGG - Intronic
1184855604 22:47144839-47144861 CACGGGCTGCACCCAGTCCCAGG - Intronic
1184855614 22:47144883-47144905 CACGGGCTGCACCCAGTCCCAGG - Intronic
1184911800 22:47540230-47540252 CTCCTGCTGCACCCTGTGGCTGG - Intergenic
956222813 3:66922590-66922612 TTCTTGATACACCCAGGGCCTGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
962056232 3:131874432-131874454 CTCGTGTTTGGCCCAGTGCCTGG - Intronic
969866909 4:10082266-10082288 TGCGTGCTGCACCCTGTGCCAGG + Intronic
972928512 4:44041255-44041277 CTCTGGATGTGCCCAGTGCCTGG + Intergenic
975552754 4:75630441-75630463 CTCGTAAGGCGCCCAGTACCTGG + Exonic
978656928 4:111075380-111075402 CACCTGATTCACCCCGTGCCTGG - Intergenic
982222516 4:153137130-153137152 CTCCTTCTGCATCCAGTGCCTGG + Intergenic
985757797 5:1729682-1729704 CTCGTTCTGCACCCAGGCCCCGG - Intergenic
986736716 5:10673765-10673787 CCCCTGATGGAGCCAGTGCCTGG - Intergenic
987026568 5:13932767-13932789 CTCTTGATGAACCCAGTGTCTGG - Intronic
987856058 5:23422356-23422378 CTCTTGCTGCTCCCACTGCCTGG - Intergenic
998586439 5:143432133-143432155 CTGTAGATGCACCCAGTCCCAGG - Intronic
999523716 5:152380114-152380136 CTCGTGAAAGACCCAGAGCCAGG - Intergenic
1000270291 5:159677578-159677600 CTCTGGACCCACCCAGTGCCTGG + Intergenic
1001929023 5:175659480-175659502 CTTGTAATGCACCGAGTACCAGG - Intronic
1002477570 5:179476961-179476983 CTCGTGATCCACCCCCTGCTCGG + Intergenic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1013177469 6:107689927-107689949 TGCCTGAAGCACCCAGTGCCTGG + Intergenic
1016223796 6:141708762-141708784 CATGTCATGCACCCAGTCCCAGG - Intergenic
1019298810 7:292852-292874 GTGGTGATGCACCCACTCCCTGG + Intergenic
1019594908 7:1854004-1854026 ATCGTGAAGCTCCCAGTGCACGG - Intronic
1024225954 7:47327104-47327126 CCCGTGCTACCCCCAGTGCCTGG + Intronic
1031258131 7:119482522-119482544 CTCTGCATGCACCCAGTCCCTGG + Intergenic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1042204271 8:66312673-66312695 CTCCTGGTGCTCCCTGTGCCTGG + Intergenic
1045601613 8:103723595-103723617 CTCTAGATCCACCCAGTACCAGG - Intronic
1048722230 8:137339009-137339031 CTCCTGCTGTACCCAGTGCTGGG + Intergenic
1049698016 8:143993136-143993158 CTGGTGCTGCCCCCAGTCCCTGG - Exonic
1052965567 9:34338075-34338097 CTCGTGATCCACCCAGGGAGAGG + Intronic
1053123597 9:35562792-35562814 CTCATGCTGCCCCCACTGCCCGG + Intronic
1058898222 9:109418367-109418389 CTCTTTATGCAATCAGTGCCAGG - Intronic
1059446990 9:114344349-114344371 GTCGTGCTCCGCCCAGTGCCTGG + Intronic
1061883715 9:133580384-133580406 CTCCTGCTGCACCCCGTCCCCGG - Intronic
1062403597 9:136383157-136383179 CCCGTGGTACACCCAGGGCCGGG + Intronic
1187027835 X:15454739-15454761 ATCTTGATGCACTCAATGCCAGG + Intronic
1193297080 X:79846115-79846137 CTCTGTATGCACCCAGGGCCTGG - Intergenic
1193409085 X:81141207-81141229 CTCTGGATTCACCCAGTGCCTGG + Intronic
1201756667 Y:17494029-17494051 CTGGAGATGGACCCAGTTCCCGG + Intergenic
1201844886 Y:18411955-18411977 CTGGAGATGGACCCAGTTCCCGG - Intergenic