ID: 1034358587

View in Genome Browser
Species Human (GRCh38)
Location 7:150474003-150474025
Sequence GTCCCACAGGCCCAAGGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034358579_1034358587 24 Left 1034358579 7:150473956-150473978 CCACATCCATATTCAACTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 207
Right 1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG 0: 1
1: 0
2: 0
3: 38
4: 272
1034358581_1034358587 18 Left 1034358581 7:150473962-150473984 CCATATTCAACTGCAGGAAGAGA 0: 1
1: 0
2: 2
3: 19
4: 189
Right 1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG 0: 1
1: 0
2: 0
3: 38
4: 272
1034358577_1034358587 29 Left 1034358577 7:150473951-150473973 CCTGCCCACATCCATATTCAACT 0: 1
1: 0
2: 0
3: 7
4: 187
Right 1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG 0: 1
1: 0
2: 0
3: 38
4: 272
1034358578_1034358587 25 Left 1034358578 7:150473955-150473977 CCCACATCCATATTCAACTGCAG 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG 0: 1
1: 0
2: 0
3: 38
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034358587 Original CRISPR GTCCCACAGGCCCAAGGGAA AGG Exonic
900830466 1:4961713-4961735 GCCCCAAAGCCCCAAGGGACAGG + Intergenic
901621527 1:10592204-10592226 GTCCCTAAAGACCAAGGGAAGGG - Intronic
903561477 1:24231388-24231410 GTCCCACATCCCCAAGGAATGGG + Intergenic
903796713 1:25934557-25934579 GGTCCACAGGCCCAAGGGGAGGG - Intergenic
904812273 1:33171100-33171122 GAAACACAGGCCCAAGGGAAGGG + Intronic
905352899 1:37359818-37359840 TTCCCACAGTCCTCAGGGAAGGG - Intergenic
906124656 1:43420308-43420330 GTCACACTGGCCAAAGGTAAGGG + Exonic
906577456 1:46903813-46903835 GTGCCACAGAACCAAGGAAATGG + Intergenic
906805835 1:48777808-48777830 GTAACACAGGCCCAAGGCTAGGG + Intronic
907547759 1:55277048-55277070 GACCCCCAGGCCAAAGGGAGTGG - Intergenic
914004326 1:143719180-143719202 GTCCCCCAGGCCTAAGGATAAGG - Intergenic
914266016 1:146038991-146039013 GTTCCAGAGTCACAAGGGAAGGG - Intergenic
915622234 1:157092804-157092826 GTCCCTCAGGCCCGAGGGGCTGG - Exonic
917709627 1:177671132-177671154 ATCCCAGAAGACCAAGGGAAGGG - Intergenic
918383919 1:183985766-183985788 TCCCCAGAGGCTCAAGGGAATGG + Intronic
920854262 1:209650738-209650760 TCCCCAAAGGCCCAAAGGAATGG + Intronic
921152280 1:212412246-212412268 GTCTCACTGGCCAAAGGGAGAGG + Intronic
922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG + Intergenic
922329398 1:224560835-224560857 TTCCCACAGACCCAGGGGAATGG - Intronic
922567426 1:226610111-226610133 GTCACTCACACCCAAGGGAAGGG + Intergenic
922721834 1:227903555-227903577 GTCCCCCAGACCCCAGGGTAGGG - Intergenic
1068052311 10:51966341-51966363 GTTCCACAGGCCACAGAGAAAGG - Intronic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1070965441 10:80527560-80527582 GTCCCATAGGCCTGAAGGAAGGG - Exonic
1072608188 10:97000717-97000739 GGGCCACAGGCCAAAGGGAAGGG + Exonic
1073155382 10:101342204-101342226 GGCCCCAAGGGCCAAGGGAAGGG - Intergenic
1073339771 10:102735785-102735807 ATCCCCCATCCCCAAGGGAAAGG - Intronic
1073349881 10:102812181-102812203 GTCCCACAGGCCTCAGGGCCAGG - Intronic
1074345930 10:112686471-112686493 GGCAGACAGGCCCAAGGGTAGGG - Intronic
1074652472 10:115539750-115539772 GAACCACAATCCCAAGGGAAGGG + Intronic
1074759117 10:116652770-116652792 CACCCACAGGCTCAAAGGAAAGG - Intergenic
1075265813 10:120999040-120999062 GTCCCAAAGGACCCAGGGAGGGG + Intergenic
1075874243 10:125793373-125793395 CTCCTACAGGCCCAGGGGAGAGG + Intronic
1076473324 10:130735374-130735396 GGCCCACAGGCACCAGGGGAGGG + Intergenic
1077679515 11:4225617-4225639 GTCCCAAAGCCCCAAGGGACTGG + Intergenic
1077681972 11:4250290-4250312 GTCCCAAAGCCCCAAGGGACTGG - Intergenic
1077688929 11:4322197-4322219 GTCCCAAAGCCCCAAGGGACTGG + Intergenic
1078160432 11:8835474-8835496 ATCCCACAGGCAAAAAGGAAAGG + Intronic
1079097074 11:17517876-17517898 GTCCCAGAGCTCCAAGGCAAGGG - Intronic
1079955571 11:26859668-26859690 GTCCCACACGTGCAAGAGAAGGG + Intergenic
1080424305 11:32142284-32142306 GCCCCGCAGGCCTAAGGGAAGGG + Intergenic
1083615522 11:64024211-64024233 GTCCTTCAGGGCCATGGGAATGG - Intronic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085600032 11:77847237-77847259 TTCCCAAAGGCCAAAGTGAAGGG - Intronic
1085660705 11:78363957-78363979 TACCCACAGACCTAAGGGAAAGG + Intronic
1086008337 11:82067570-82067592 CACCCACAGGCCCAAAGAAAAGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089305244 11:117522336-117522358 GGCCCACAGTCCAGAGGGAAAGG - Intronic
1089546834 11:119233845-119233867 GGCCAACAGGCCCAAAGGAAAGG - Intronic
1089752392 11:120660928-120660950 GTCCCACAGCAACAAGGCAAGGG - Intronic
1090749026 11:129729885-129729907 GTCCCACAGTCACACGGAAAAGG - Intergenic
1090920726 11:131203960-131203982 GACCCACAGGCCCAAGTAAAGGG - Intergenic
1091027775 11:132157480-132157502 GTCCCAGGGGCCCTAGGGTATGG + Intronic
1091903538 12:4164776-4164798 GTCCCCCAGGCTCCAGGGAAGGG - Intergenic
1091938006 12:4448815-4448837 GTCCCTAAGCCCCAAGAGAAGGG - Intergenic
1092210975 12:6646432-6646454 GTGCCCCAGGGCCAAGGGAGAGG - Intronic
1094375953 12:29787546-29787568 GTACCACAGGCCCATGGGTTGGG - Intergenic
1095948881 12:47770724-47770746 CTCCCCCAGCCCCAAGGGGAGGG + Intronic
1096074862 12:48796970-48796992 GTGGCAGAGGCCTAAGGGAAAGG - Intergenic
1096717587 12:53500577-53500599 GTCACGGAGGCCCAAGGGCAAGG + Intergenic
1102429131 12:112868003-112868025 GACCCACAGGGCCAGGAGAAAGG + Intronic
1102614619 12:114142503-114142525 GTCCCAGAGGTCCTAGGGAGAGG + Intergenic
1103852066 12:123939891-123939913 GTCCCACAGGCCCTGGGGGAAGG - Intronic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1105292219 13:19060455-19060477 TCCCCACAGGCCCAGGGGCAGGG + Intergenic
1107552987 13:41494381-41494403 CTCCCAGGAGCCCAAGGGAATGG - Intergenic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1111064747 13:83075171-83075193 TACCCACAGGCTCAAAGGAAAGG + Intergenic
1112734409 13:102400722-102400744 GTCCCACAGGGCCAGGGGTGGGG - Intronic
1112851270 13:103709253-103709275 GAACCAAAGGGCCAAGGGAAAGG - Intergenic
1114675937 14:24440422-24440444 GCCCCCCAGGCCCAGGCGAAAGG + Exonic
1115109387 14:29803131-29803153 GACCCACAGGCTTAAGGAAAAGG + Intronic
1115702554 14:35968849-35968871 GTCCCAAGGGCCACAGGGAATGG - Intergenic
1118642575 14:67806389-67806411 CTCCCACAGTCCCATGGGAAAGG - Intronic
1119180846 14:72604419-72604441 GTCCCATAGGCACACAGGAAGGG - Intergenic
1119448092 14:74683485-74683507 GTCCCACAGGCCGATGTGCAGGG + Exonic
1119666986 14:76491777-76491799 TGCCCACAGGCCCCAGGGATGGG - Intronic
1119748808 14:77063438-77063460 GACCCAGAGACCCAAAGGAAAGG + Intergenic
1122248304 14:100419982-100420004 CTCACACAAGCCCAAGGCAATGG - Intronic
1122694220 14:103545048-103545070 GTCCCACAGGCCCAGCGGTGGGG - Intergenic
1123134178 14:106012084-106012106 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1123138854 14:106055709-106055731 GTCCCCCAGGCTCCAGGGAAGGG - Intergenic
1123139610 14:106062314-106062336 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123141923 14:106088287-106088309 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123148097 14:106153793-106153815 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123156846 14:106235227-106235249 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123159975 14:106268771-106268793 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123162189 14:106289191-106289213 GTCCGCCAGGCTCCAGGGAATGG - Intergenic
1123178352 14:106443294-106443316 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123187931 14:106537975-106537997 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123189688 14:106557107-106557129 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123193401 14:106592838-106592860 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123194821 14:106606278-106606300 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1123200390 14:106657888-106657910 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123202033 14:106675177-106675199 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123207618 14:106728325-106728347 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123214122 14:106790863-106790885 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123222870 14:106872913-106872935 GTCCGCCAGTCCCCAGGGAAGGG - Intergenic
1202943432 14_KI270726v1_random:5126-5148 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1123401120 15:19987827-19987849 GTCCGCCAGGCTCAAGGGAAAGG - Intergenic
1123584209 15:21742526-21742548 GTCCGCCAGCCCCCAGGGAAGGG - Exonic
1123620860 15:22185129-22185151 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1125479829 15:40072426-40072448 GCCCGACAGCCACAAGGGAACGG - Intergenic
1128067459 15:64774183-64774205 CTCCCCCAGGCCAAGGGGAAGGG + Intronic
1128310980 15:66631735-66631757 GTTCCCCAGGCCCCAGGGCAGGG + Intronic
1129301104 15:74626066-74626088 GTCCCTCAGGCCCAGGAGAATGG - Intronic
1131568426 15:93506896-93506918 GTCCCACTGGCTCGCGGGAAAGG + Intergenic
1132010455 15:98271061-98271083 GTCTCTAAGGCCCAAGGGCAGGG - Intergenic
1132075491 15:98816488-98816510 GTCCTACTGGCACAAGAGAATGG - Intronic
1132149153 15:99447411-99447433 GTCCCGCGGGCCCAGAGGAAGGG - Intergenic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1132630103 16:913155-913177 GTCCCCCTGGCTAAAGGGAAGGG - Intronic
1132872553 16:2122296-2122318 GTCCCACAGCCCCTGGGGGAAGG - Intronic
1132883840 16:2173768-2173790 GTCCTGCAGGGCCAAGGGCAGGG - Exonic
1133113180 16:3561817-3561839 GTCCCACCCGCCCACGGGCAGGG + Intronic
1134075837 16:11290705-11290727 GTCACACAGGCCCAAGGCTGTGG + Intronic
1134122643 16:11596133-11596155 GTCCCACACCCCGAGGGGAAGGG - Intronic
1134551651 16:15141496-15141518 GTCCCACAGCCCCTGGGGGAAGG - Intergenic
1136682105 16:31973842-31973864 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136694560 16:32066173-32066195 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136782417 16:32915343-32915365 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136795061 16:33009437-33009459 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136874852 16:33844945-33844967 GTCCGCCAGGCTCCAGGGAAGGG - Exonic
1136887376 16:33938508-33938530 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1138007882 16:53354791-53354813 GCCCCCCAGCCCCAAGGGAATGG + Intergenic
1138113850 16:54344840-54344862 GTCCCACATTCCCAAGGTTAAGG - Intergenic
1138381769 16:56607716-56607738 GACCCTCAGGCCCAAGGCAATGG + Intergenic
1138382333 16:56611288-56611310 GACCCTCAGGCCCAAGGCAATGG + Intergenic
1139870971 16:70108377-70108399 GGCACACAGGCCCAGGTGAAAGG + Intergenic
1140375904 16:74445496-74445518 GGCACACAGGCCCAGGTGAAAGG - Intergenic
1141657807 16:85425338-85425360 CACCCCCAGGGCCAAGGGAAAGG + Intergenic
1203085077 16_KI270728v1_random:1179330-1179352 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1142670147 17:1484357-1484379 GTCCCACAGGCGCAGGGAAGTGG - Intronic
1142979514 17:3663565-3663587 GTCCCAGAGGCCCCAGGCCAGGG + Exonic
1143539359 17:7560102-7560124 GGCCTACAGGCCCAAGGATATGG + Exonic
1143881789 17:10035506-10035528 TTCCCACAGTGCCAGGGGAAGGG - Intronic
1144062121 17:11592228-11592250 GGCCCAAAAGCCCAAGTGAAAGG + Intergenic
1147384806 17:40074845-40074867 ATCCCACATGCTCAAGGTAAGGG - Intronic
1149310023 17:55384593-55384615 GGCCCACAGGCACAAGTGCAAGG - Intergenic
1150248690 17:63694231-63694253 CTCCCACAAGCCTGAGGGAAAGG + Exonic
1151171595 17:72250983-72251005 GTCCCAGAGACCCATGGAAAAGG + Intergenic
1151538045 17:74749580-74749602 CACCCACAGACCCGAGGGAAGGG - Intronic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1152580759 17:81164726-81164748 GTCTCCCCGGCCCAAGGGCAGGG - Intronic
1154324508 18:13380201-13380223 CACCCACATGCACAAGGGAATGG - Intronic
1154344291 18:13529308-13529330 CTCCCACATTCCAAAGGGAAAGG + Intronic
1156907149 18:42367503-42367525 GTCACACAGCCTCAAGGAAATGG - Intergenic
1157669424 18:49515779-49515801 GGCCCAGAGGCACAAGGGAGAGG - Intergenic
1157808055 18:50672929-50672951 GACCCACAGGCACATTGGAAAGG - Intronic
1159460850 18:68721033-68721055 GTCCCACAGGCTGGAGGGCAGGG - Intronic
1160586162 18:79914747-79914769 GGCCCACAGGCCCAAAGAGACGG + Intronic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1161775734 19:6261133-6261155 GCCCCATAGGCCCAAAGGCAGGG + Intronic
1161857500 19:6773921-6773943 GTCCCCCAGGCCCCAGGATAGGG - Intronic
1161868232 19:6850507-6850529 GTAGCAAAGGCCCCAGGGAATGG + Intronic
1161874673 19:6898838-6898860 CACCCACAGGCCCAAAGTAAAGG - Intronic
1163488761 19:17605209-17605231 GGCACACAGGCCTAAGGGAGGGG + Exonic
1165025354 19:32957017-32957039 GTCCCACAGCTCAAAGGGGAAGG - Intronic
1165061522 19:33207310-33207332 GTCTCGCAGGCCCGAGGGCAAGG - Exonic
1165900002 19:39164954-39164976 GCTGCACAGGCCCATGGGAAAGG + Intronic
1166015102 19:39973858-39973880 CTCCCACAGGTCAAAGAGAAAGG - Intronic
1166872005 19:45876795-45876817 GACCCCCAGGCCCGAGGGAGGGG - Intergenic
1167028632 19:46941233-46941255 GTTCCACAGGCAAAAAGGAATGG - Intronic
1167637101 19:50661588-50661610 GTCCCCCAGGCCGCAGGGGAAGG - Intronic
1168044394 19:53783925-53783947 GTCACACAGGCTAAAGTGAATGG + Intergenic
1168278191 19:55288547-55288569 GTCCCAGAGGCTTATGGGAAGGG + Intronic
925020241 2:562916-562938 GCCCCGCAGGCCCAGGTGAATGG - Intergenic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
925342140 2:3145219-3145241 GTTCTACAGGATCAAGGGAAAGG - Intergenic
925417157 2:3678373-3678395 GTCCCACAGTGCCAGAGGAACGG - Intronic
925906065 2:8540255-8540277 GTCCTGGAGGCCCCAGGGAAGGG - Intergenic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
926729740 2:16027181-16027203 ATCCCACAGGCTGAAGGCAAGGG - Intergenic
927874697 2:26647600-26647622 CTCCCACATGCCCCAGGGAGGGG + Intergenic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
932292410 2:70593751-70593773 GTCCCACAGCCCCAGGGCACAGG + Intergenic
932588270 2:73045722-73045744 GTCTCGGAGGCCCAAGGTAATGG + Intronic
933221812 2:79699124-79699146 GTCCTACAGGCATATGGGAAAGG - Intronic
934511532 2:94948024-94948046 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
934512047 2:94953322-94953344 GTGCCACAGGCCCCTGGAAAAGG - Intergenic
934718127 2:96554890-96554912 TTCCCAGAGGCCCCAGGGCATGG - Intergenic
937854553 2:126662978-126663000 GTCCCACAGAGACCAGGGAAAGG + Intronic
938146540 2:128839219-128839241 GTCCCAGAGGCCCCAGGAACAGG - Intergenic
938595691 2:132785099-132785121 GGCCCACAGGGCCAAGGCCATGG - Exonic
946153000 2:217788960-217788982 GTCCCAAAGGCCCAAAGAACGGG + Intergenic
1169137014 20:3203609-3203631 TTCACACAGGCCCGAGGGAAGGG - Intronic
1171382762 20:24745999-24746021 GTCCCACAGTCGGATGGGAATGG + Intergenic
1173036567 20:39417285-39417307 GTCCAACAAGCAGAAGGGAAGGG - Intergenic
1174039190 20:47687057-47687079 GTCCCGCAGGCCCAAGGGCCCGG + Intronic
1174519637 20:51119578-51119600 GTCCCAAAGGACTAGGGGAAGGG - Intergenic
1174926315 20:54763776-54763798 CTCACACAGGCCCAATTGAAGGG - Intergenic
1175306743 20:57981467-57981489 GTCCCACAAGGCCAAGGTCAGGG + Intergenic
1176019782 20:62956756-62956778 GTCCCACAGGCCCGAGTGCCAGG + Exonic
1179982022 21:44900592-44900614 GTCCCTGAGACCCAGGGGAAAGG - Intronic
1180095217 21:45553236-45553258 CTCCCACCGGCCTAAGGGGACGG + Intergenic
1181563265 22:23717744-23717766 GTCCCAGAGGCCCAGGGTCAGGG - Intergenic
1182947756 22:34340718-34340740 GTCTCAGAGTCCCAAGGGGAAGG - Intergenic
1183161584 22:36117185-36117207 GGCCCACAGGCCCCTGGGAGAGG - Intergenic
1183230142 22:36577020-36577042 GTCGCACAGGCTCAGGAGAAAGG + Intronic
1183350010 22:37329812-37329834 GTCCCACCGGCCAAAGGAGAAGG - Intergenic
1183647445 22:39134704-39134726 CTCCCACAAGGCCAAGGGCAAGG - Exonic
1184364193 22:44039065-44039087 GCCCCGCAGACCCATGGGAAAGG + Intronic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1185081313 22:48710823-48710845 GCCCGTGAGGCCCAAGGGAAAGG - Intronic
1185172866 22:49303844-49303866 GTCCCAGACACCCAAGGGAGAGG + Intergenic
1185336929 22:50274907-50274929 GACCCACAGAGCCCAGGGAAGGG + Intergenic
954001001 3:47556934-47556956 GTTTTCCAGGCCCAAGGGAAAGG - Intergenic
954214883 3:49119107-49119129 GTGCCACAGGCCCAAGGAGAGGG - Exonic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
955492855 3:59500422-59500444 ACCCCACAGGCCCACAGGAATGG + Intergenic
956484785 3:69710917-69710939 GTCCCACTGTCCCAATGGTATGG - Intergenic
956643969 3:71438603-71438625 GTCCAAAAGACCCAAGGGAGAGG - Intronic
960763636 3:121099877-121099899 GACCCACAGGCTCAAAGGAAAGG + Intronic
961017607 3:123479766-123479788 GCCCGCCAGTCCCAAGGGAAAGG + Intergenic
961404295 3:126667681-126667703 CTCTCACAGGGCTAAGGGAAGGG - Intergenic
964636982 3:158868863-158868885 GAGCCACTGGCCCAAGGGACTGG - Intergenic
964706590 3:159625098-159625120 GTTCCACAGACCCAAGGCAAAGG - Intronic
966157737 3:176935335-176935357 ATCCAATAGGCCCAAGGGACTGG - Intergenic
966318852 3:178678368-178678390 GGCCCACAGGCAAGAGGGAATGG - Intronic
966807857 3:183820336-183820358 GTCCCAGAGGCCCACTGGCATGG + Intronic
968664695 4:1814738-1814760 GTGCCACAGACCCTGGGGAAGGG + Intronic
969353666 4:6612858-6612880 GGCCCACATAACCAAGGGAAGGG + Intronic
969859680 4:10025818-10025840 CTCCCACTGACCCAGGGGAAAGG + Intronic
971361400 4:25941489-25941511 GTCCTACAGCCACAAGGGATTGG + Intergenic
972845562 4:42984843-42984865 GTCCCACAGTCCCAAGCGTTTGG - Intronic
976226176 4:82797455-82797477 GTCCCTGGGGCCCAGGGGAAGGG + Intronic
979703131 4:123689952-123689974 GTTCCACAGGTCCCTGGGAAGGG + Intergenic
979765826 4:124463139-124463161 GTCCCACAGGGCCATGTGGATGG + Intergenic
982163917 4:152597430-152597452 GGCCCAAAGGGCCAAGGAAAAGG - Intergenic
984140626 4:176001147-176001169 TTCCCACAGGCTCAAGGGTTAGG - Intronic
985468399 5:20232-20254 GGCTCACAAGCCCAAGGCAAAGG - Intergenic
985675920 5:1231296-1231318 GCCCCACAGGCCCCAGGGCAGGG - Intronic
989451986 5:41597388-41597410 GTCCAAAAGGCCAGAGGGAATGG + Intergenic
990240864 5:53815362-53815384 GTCTCACAGACCTAAGGTAACGG - Intergenic
990302136 5:54459830-54459852 GTCCCCCAGGTCCAAAGGGATGG + Intergenic
990441970 5:55855666-55855688 GTCTCACAGGACCAAAGCAAAGG - Intronic
990991258 5:61686240-61686262 GTCCCAAATCCCCAAGGGCAGGG + Intronic
991951189 5:71948110-71948132 GACCCAAAGGGCCCAGGGAAAGG - Intergenic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
994422000 5:99534180-99534202 GTCCCCTAGATCCAAGGGAAGGG + Intergenic
994460843 5:100066404-100066426 GTCCCCTAGATCCAAGGGAAGGG - Intergenic
994484990 5:100379829-100379851 GTCCCCTAGATCCAAGGGAAGGG - Intergenic
997241461 5:132311451-132311473 ATCCCACAGACCCTAGGGAATGG + Intronic
997384143 5:133459168-133459190 GCCTCTCAGGCCCAAGGAAATGG - Intronic
998461142 5:142311130-142311152 GTACCAAAGGACCAAAGGAAGGG + Exonic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999777619 5:154823586-154823608 GATCCACCTGCCCAAGGGAAGGG + Exonic
1002928675 6:1619423-1619445 GCCCCACAGGCACCAGGGACTGG - Intergenic
1003196026 6:3915655-3915677 GCCTCACAGGGCCAAGGGAAAGG - Intergenic
1003436195 6:6090832-6090854 GCCTCACAGGGCCAAGGGAAAGG + Intergenic
1003640727 6:7873133-7873155 TTAGCACAGGCCCAAGTGAAAGG + Intronic
1006404314 6:33835289-33835311 GCCCCACAGGCCACAGGGATTGG - Intergenic
1006514548 6:34538659-34538681 GTGCCACAGGCCCCAGTGAATGG + Intronic
1006788818 6:36685638-36685660 GCCCCATTGGCCCCAGGGAAGGG + Intronic
1007260687 6:40561138-40561160 GGAACTCAGGCCCAAGGGAAAGG + Intronic
1007788436 6:44295392-44295414 GGACCACAGTCCCCAGGGAAAGG + Intronic
1008956842 6:57224751-57224773 GTCCAACAATCCCAAGGAAATGG - Intergenic
1010145940 6:72669561-72669583 CCACCACAGGCCCAAGGGGAGGG - Intronic
1010163360 6:72885735-72885757 ATCACACATGCACAAGGGAAAGG + Intronic
1012259758 6:97073948-97073970 GTGCCACAGGCCCTAGGAAGTGG + Intronic
1013414654 6:109913640-109913662 GCCCAACAGGCCCAAGGCAAAGG + Intergenic
1013429060 6:110039898-110039920 GTCCCACACACCGAAGGAAAGGG - Intergenic
1015281080 6:131434377-131434399 GTCCCACTGGGACAAAGGAAAGG + Intergenic
1019225000 6:170501951-170501973 GTCCCACAGCCATCAGGGAAAGG + Intergenic
1020274480 7:6615969-6615991 GTCGCCCTGGGCCAAGGGAAGGG - Exonic
1023045984 7:36210583-36210605 GCCACACAGGTCCCAGGGAAGGG - Intronic
1023877365 7:44294241-44294263 GTATCACAGGACCAACGGAAGGG + Intronic
1024376014 7:48638952-48638974 GTCACACAACTCCAAGGGAATGG - Intronic
1029171547 7:98633015-98633037 GTCCTTCAGGCCAAAGCGAAAGG + Intergenic
1029536866 7:101162466-101162488 ACCACACAGGCCCAAGGGGACGG + Intergenic
1029660181 7:101955237-101955259 GTCCAACAGGGAGAAGGGAATGG - Intronic
1029711778 7:102303771-102303793 GTCACTCAGGCCCAAGGCACTGG - Intronic
1030077012 7:105745677-105745699 GTCCCAAAGGCCAAGGGGATCGG - Intronic
1031739474 7:125411573-125411595 GTCGGGCAGCCCCAAGGGAAAGG + Intergenic
1032182309 7:129690779-129690801 AACCCAAAGGCCCAAGTGAAAGG - Intronic
1032544052 7:132727309-132727331 GTCCCCAAGGCCCAGGGGAAGGG - Intronic
1033219975 7:139521333-139521355 GTTCCAAAGGCCCAAAGGACAGG + Intergenic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1036075102 8:5489911-5489933 CACCCACAGGCCCAAGGGAGAGG - Intergenic
1037748834 8:21666932-21666954 GGCCCAGAGGCTCCAGGGAACGG - Intergenic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042432846 8:68727850-68727872 GCCCCACAGGCCCAGGAGGATGG - Intronic
1046999876 8:120563040-120563062 GTCCCATGGGCCTGAGGGAAGGG - Intronic
1047844000 8:128786262-128786284 GTCCCTTTGGCCCAAGTGAAAGG - Intergenic
1048907981 8:139106600-139106622 TTCCCACAGGCTCAAGAAAAAGG - Intergenic
1049013554 8:139904305-139904327 GTCACAGGAGCCCAAGGGAAGGG + Intronic
1049781090 8:144429296-144429318 GTCCCACAGGCCCAGGCCCAGGG + Exonic
1052665124 9:31486528-31486550 GACCCACAGGAACAAGAGAATGG - Intergenic
1053443622 9:38135473-38135495 CTGCCTCAGGCCCCAGGGAAAGG - Intergenic
1053495469 9:38545481-38545503 TTCCAACAGGACAAAGGGAAAGG - Intronic
1054743430 9:68830911-68830933 GAGCCACAGGCCTCAGGGAAAGG - Intronic
1054849435 9:69831663-69831685 GTCCAACAGGCCTAAGTTAAAGG - Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1057082256 9:92181619-92181641 GTCCCCCTGGCCCGTGGGAAGGG - Intergenic
1058402844 9:104637160-104637182 GTGCCTCAGCCCCAGGGGAATGG + Intergenic
1061816376 9:133199800-133199822 GACCCACAGGCCCCACGGAAAGG + Intergenic
1061857133 9:133448558-133448580 GACCCAGAGCCCCAAGGGACAGG - Intronic
1185925988 X:4147069-4147091 GACCACCAGGCCCTAGGGAAAGG + Intergenic
1186026345 X:5317689-5317711 CTTCCACAGGCCCTGGGGAATGG - Intergenic
1186936152 X:14451746-14451768 CACCCACAGGCTCAAAGGAAAGG + Intergenic
1187912691 X:24125293-24125315 GTCCCACAGGACCTTGCGAAGGG - Intergenic
1188236991 X:27743168-27743190 ATCTCCCAGGCCCAAGGGATGGG + Intronic
1188368558 X:29340587-29340609 GTGCCACACGACCAAAGGAAAGG - Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1198129714 X:133681595-133681617 GTTCCACAGGCCACAGGAAATGG - Intronic
1199513659 X:148651592-148651614 GTCACAAAGTCCTAAGGGAAAGG - Intronic