ID: 1034359646

View in Genome Browser
Species Human (GRCh38)
Location 7:150483066-150483088
Sequence CTCCCAGGGCACCACTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034359646_1034359651 1 Left 1034359646 7:150483066-150483088 CCTGTCCAGTGGTGCCCTGGGAG No data
Right 1034359651 7:150483090-150483112 TCCCACTTGCAATTCAGGAATGG No data
1034359646_1034359650 -4 Left 1034359646 7:150483066-150483088 CCTGTCCAGTGGTGCCCTGGGAG No data
Right 1034359650 7:150483085-150483107 GGAGATCCCACTTGCAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034359646 Original CRISPR CTCCCAGGGCACCACTGGAC AGG (reversed) Intergenic
No off target data available for this crispr