ID: 1034367168

View in Genome Browser
Species Human (GRCh38)
Location 7:150561096-150561118
Sequence ACCTGCGGGTACCCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034367162_1034367168 6 Left 1034367162 7:150561067-150561089 CCCTTTTGTTGGGGTCCAGCCTC No data
Right 1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG No data
1034367159_1034367168 16 Left 1034367159 7:150561057-150561079 CCATTATCATCCCTTTTGTTGGG No data
Right 1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG No data
1034367163_1034367168 5 Left 1034367163 7:150561068-150561090 CCTTTTGTTGGGGTCCAGCCTCA No data
Right 1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG No data
1034367165_1034367168 -9 Left 1034367165 7:150561082-150561104 CCAGCCTCAACACTACCTGCGGG No data
Right 1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034367168 Original CRISPR ACCTGCGGGTACCCAAAGTC TGG Intergenic
No off target data available for this crispr