ID: 1034369875

View in Genome Browser
Species Human (GRCh38)
Location 7:150585575-150585597
Sequence GAACCATGGATCCCAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034369866_1034369875 17 Left 1034369866 7:150585535-150585557 CCCTCAAGGTGTGTACAACCATG No data
Right 1034369875 7:150585575-150585597 GAACCATGGATCCCAGCCACAGG No data
1034369867_1034369875 16 Left 1034369867 7:150585536-150585558 CCTCAAGGTGTGTACAACCATGG No data
Right 1034369875 7:150585575-150585597 GAACCATGGATCCCAGCCACAGG No data
1034369865_1034369875 28 Left 1034369865 7:150585524-150585546 CCATGTGGGTGCCCTCAAGGTGT No data
Right 1034369875 7:150585575-150585597 GAACCATGGATCCCAGCCACAGG No data
1034369872_1034369875 -1 Left 1034369872 7:150585553-150585575 CCATGGAACAGGAGATTGGAGGG No data
Right 1034369875 7:150585575-150585597 GAACCATGGATCCCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034369875 Original CRISPR GAACCATGGATCCCAGCCAC AGG Intergenic
No off target data available for this crispr