ID: 1034378383

View in Genome Browser
Species Human (GRCh38)
Location 7:150666607-150666629
Sequence AACCAGCACACATGGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034378383_1034378390 28 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378390 7:150666658-150666680 TTGTACAGATGGAGCCAGGTTGG No data
1034378383_1034378385 -3 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378385 7:150666627-150666649 GTTTCATTTCCTCAGCAACATGG No data
1034378383_1034378389 24 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data
1034378383_1034378388 17 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378388 7:150666647-150666669 TGGGAAGACATTTGTACAGATGG No data
1034378383_1034378386 -2 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378386 7:150666628-150666650 TTTCATTTCCTCAGCAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034378383 Original CRISPR AACCAGCACACATGGAGAAA TGG (reversed) Intergenic
No off target data available for this crispr