ID: 1034378384

View in Genome Browser
Species Human (GRCh38)
Location 7:150666615-150666637
Sequence GGAAATGAAACCAGCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034378384_1034378386 -10 Left 1034378384 7:150666615-150666637 CCATGTGTGCTGGTTTCATTTCC No data
Right 1034378386 7:150666628-150666650 TTTCATTTCCTCAGCAACATGGG No data
1034378384_1034378389 16 Left 1034378384 7:150666615-150666637 CCATGTGTGCTGGTTTCATTTCC No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data
1034378384_1034378390 20 Left 1034378384 7:150666615-150666637 CCATGTGTGCTGGTTTCATTTCC No data
Right 1034378390 7:150666658-150666680 TTGTACAGATGGAGCCAGGTTGG No data
1034378384_1034378388 9 Left 1034378384 7:150666615-150666637 CCATGTGTGCTGGTTTCATTTCC No data
Right 1034378388 7:150666647-150666669 TGGGAAGACATTTGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034378384 Original CRISPR GGAAATGAAACCAGCACACA TGG (reversed) Intergenic
No off target data available for this crispr