ID: 1034378387

View in Genome Browser
Species Human (GRCh38)
Location 7:150666636-150666658
Sequence AATGTCTTCCCATGTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034378387_1034378389 -5 Left 1034378387 7:150666636-150666658 CCTCAGCAACATGGGAAGACATT No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data
1034378387_1034378390 -1 Left 1034378387 7:150666636-150666658 CCTCAGCAACATGGGAAGACATT No data
Right 1034378390 7:150666658-150666680 TTGTACAGATGGAGCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034378387 Original CRISPR AATGTCTTCCCATGTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr