ID: 1034378389

View in Genome Browser
Species Human (GRCh38)
Location 7:150666654-150666676
Sequence ACATTTGTACAGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034378387_1034378389 -5 Left 1034378387 7:150666636-150666658 CCTCAGCAACATGGGAAGACATT No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data
1034378384_1034378389 16 Left 1034378384 7:150666615-150666637 CCATGTGTGCTGGTTTCATTTCC No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data
1034378383_1034378389 24 Left 1034378383 7:150666607-150666629 CCATTTCTCCATGTGTGCTGGTT No data
Right 1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034378389 Original CRISPR ACATTTGTACAGATGGAGCC AGG Intergenic
No off target data available for this crispr