ID: 1034385440

View in Genome Browser
Species Human (GRCh38)
Location 7:150737153-150737175
Sequence TGCCCCGGTGATGGGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034385434_1034385440 1 Left 1034385434 7:150737129-150737151 CCCAAGAGTGCTGGGAGGAGAAG 0: 1
1: 0
2: 2
3: 23
4: 414
Right 1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG 0: 1
1: 0
2: 4
3: 20
4: 228
1034385435_1034385440 0 Left 1034385435 7:150737130-150737152 CCAAGAGTGCTGGGAGGAGAAGG 0: 1
1: 0
2: 1
3: 106
4: 2410
Right 1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG 0: 1
1: 0
2: 4
3: 20
4: 228
1034385426_1034385440 27 Left 1034385426 7:150737103-150737125 CCAGAAGCAGAGCCTGTGAGAAG 0: 1
1: 0
2: 12
3: 89
4: 512
Right 1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG 0: 1
1: 0
2: 4
3: 20
4: 228
1034385430_1034385440 15 Left 1034385430 7:150737115-150737137 CCTGTGAGAAGGGGCCCAAGAGT 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG 0: 1
1: 0
2: 4
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034385440 Original CRISPR TGCCCCGGTGATGGGTGCTG AGG Intronic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900390477 1:2431788-2431810 TGCCTGGGTGGTGGATGCTGAGG + Intronic
900431372 1:2604631-2604653 TGCCAGGGTGGTGGGTGCCGGGG + Intronic
901527986 1:9836025-9836047 TGGCCCGGAGAGGGGTGGTGTGG + Intergenic
902991122 1:20187511-20187533 TCCCTGTGTGATGGGTGCTGGGG + Intronic
904797625 1:33069354-33069376 TGCCCTGGGGCTGGGTGCAGTGG + Intronic
905923622 1:41734729-41734751 TGCCCCGGGGCTGGCTGCTGTGG - Intronic
907393448 1:54173873-54173895 TGCCCTGGTGATGGTTGCTATGG - Intronic
908122337 1:60997994-60998016 AGCCCCGGTGGTGGAGGCTGAGG + Intronic
914490774 1:148148978-148149000 CGCCACGGTGTTGGGGGCTGGGG + Intronic
915087987 1:153401317-153401339 TGCACCTGTGCTAGGTGCTGTGG + Intergenic
916870982 1:168914315-168914337 TGCCCCAGCAGTGGGTGCTGAGG - Intergenic
917141568 1:171841140-171841162 TGCCCCGGTGGTGGCGGCGGCGG + Intergenic
920251939 1:204627760-204627782 AGCCCAGGAGATGGGTGCAGGGG - Intronic
1063173970 10:3535206-3535228 TGCCCGGGTGCTGTGTGCCGTGG + Intergenic
1063489878 10:6454271-6454293 TGCCCTGGTGATGGATGATAAGG + Intronic
1063574715 10:7251506-7251528 TTTCCCGCTGATGGGTACTGGGG - Intronic
1063583325 10:7329384-7329406 TGCTGCGCTGATGGCTGCTGAGG - Intronic
1063661175 10:8035959-8035981 TGCCCCGCAGTTGGGTGCCGGGG - Intergenic
1064002267 10:11673541-11673563 TGGCCCTGTGCTGTGTGCTGAGG + Intergenic
1065978041 10:30860896-30860918 TGGCCCTGTGATGGGGGATGGGG + Intronic
1066054203 10:31665135-31665157 TGCCCCTGTGAAGGGAGTTGTGG - Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1067150884 10:43732627-43732649 TGCCCAGGTGATGAAGGCTGGGG - Intergenic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1072816663 10:98516301-98516323 AGACCCTGTGCTGGGTGCTGAGG - Intronic
1074386127 10:113018037-113018059 TGGCACAGTGCTGGGTGCTGGGG + Intronic
1075087604 10:119423944-119423966 TGGCACTGTGCTGGGTGCTGGGG + Intronic
1075721953 10:124592622-124592644 TGCCCAGGAGGTGGGAGCTGTGG + Intronic
1075853980 10:125612377-125612399 TGGCACTTTGATGGGTGCTGGGG - Intronic
1076775671 10:132696810-132696832 TGGCCCGGCCCTGGGTGCTGTGG - Intronic
1077111513 11:864163-864185 TGCCCCAGGGATGGGGGCAGGGG + Intronic
1077486753 11:2842264-2842286 TGCCCGGGTGAAGGGCTCTGGGG + Intronic
1077488013 11:2847983-2848005 GGCCCCGATGAGGGGTCCTGAGG + Exonic
1077544767 11:3164620-3164642 TGCCCCAGAGATGGGGGCTGTGG + Intronic
1080396878 11:31898324-31898346 CGGCCCTGTGCTGGGTGCTGTGG - Intronic
1081835304 11:46148863-46148885 TGTCTCAGTGATGGGTGATGGGG + Intergenic
1081937765 11:46917259-46917281 AGCCCCGATGAAGGGAGCTGGGG - Intronic
1082986640 11:59174948-59174970 AGGCCCTGTGCTGGGTGCTGCGG + Intronic
1083967157 11:66049936-66049958 CTCCCAGGTGATGGGAGCTGAGG - Intergenic
1085393483 11:76194474-76194496 TGCCCCAGTGGTGGGGGGTGCGG - Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1095228917 12:39710978-39711000 TGCTCGGGTGATGGGTGCACCGG - Intronic
1096070662 12:48773853-48773875 AGGCCTGGTGATGGGCGCTGGGG - Intronic
1096239315 12:49951103-49951125 TGCCCAGCTGCTGGGGGCTGTGG + Exonic
1096601779 12:52734748-52734770 TGGCCCTGTGCTTGGTGCTGGGG - Intergenic
1096780018 12:53986222-53986244 TGCCCCGGCCATGGGTGCTAAGG + Intronic
1096830493 12:54310143-54310165 TGCCCCTAAGATGGGTGCGGTGG + Intronic
1101375569 12:104168442-104168464 TGCACCAGTGATCGGTTCTGTGG - Intergenic
1101606277 12:106248912-106248934 AGCCTCTGGGATGGGTGCTGCGG + Intronic
1102043821 12:109817348-109817370 TGCCATGGTGAGGGGTGCAGTGG - Intronic
1103852618 12:123943237-123943259 TGCAACGATGATGGGAGCTGGGG + Intronic
1104848304 12:131858197-131858219 TGGGGCGGTGCTGGGTGCTGTGG + Intergenic
1104944487 12:132409550-132409572 GGCCCGGGGGATGGGAGCTGTGG + Intergenic
1106777646 13:33024456-33024478 TGTCCTGCTGATGGGTGCAGAGG + Intronic
1106861252 13:33911260-33911282 TGCACTGGTGATGGAGGCTGTGG - Intronic
1111893272 13:94109216-94109238 TGCCCAGTGGATGGGTGCTATGG + Intronic
1112076801 13:95922743-95922765 AGCCCAGGAGTTGGGTGCTGTGG + Intronic
1112370357 13:98788191-98788213 TGGCCCGGGGGTGGGGGCTGAGG - Intergenic
1112548095 13:100391337-100391359 TTCACCTGTGATGGCTGCTGTGG + Intronic
1118730038 14:68659593-68659615 TGCCCCGGTGCAGTGTCCTGAGG - Intronic
1118966691 14:70593876-70593898 TGCCCCAGTGCTGGGTCCTAAGG + Intronic
1119695251 14:76708392-76708414 AGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1120513825 14:85446664-85446686 TGCCTCTGTCTTGGGTGCTGGGG - Intergenic
1122055239 14:99093662-99093684 TGGCCCTGTGGTGGGTGCTGGGG + Intergenic
1122274130 14:100582599-100582621 GGCACCTGTGTTGGGTGCTGGGG - Intronic
1122468717 14:101951421-101951443 GGCCCAGGTCATGGGTGCTGGGG - Intergenic
1122551107 14:102550487-102550509 GTCCCCCGTGATGGGTGCTCAGG + Intergenic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122809729 14:104281956-104281978 TGCTCTGGTCATGGGGGCTGAGG + Intergenic
1124109438 15:26772899-26772921 GGCCCCGGTGCTGGTGGCTGTGG - Exonic
1126428008 15:48550363-48550385 TGGCCCTGTGATGTGGGCTGTGG - Intronic
1129666417 15:77581997-77582019 TGTCCCGGGGGTGGGTGCAGCGG - Intergenic
1130068462 15:80626656-80626678 GGCCCTGGGTATGGGTGCTGTGG + Intergenic
1132079792 15:98854261-98854283 TGCTCCAGTGATGTGTGCTCCGG + Intronic
1132240273 15:100252514-100252536 CGCCCCGGACATGGGTACTGTGG + Intronic
1132347405 15:101116551-101116573 AGGCCCTGTGATGTGTGCTGGGG - Intergenic
1132647638 16:1006536-1006558 TCCCCTGGTGCTGGGGGCTGGGG - Intergenic
1132668028 16:1090764-1090786 TGGCCCAGTGGTGGGTGGTGGGG + Intronic
1134304613 16:13020955-13020977 TTCTCTGGTGATTGGTGCTGGGG + Intronic
1134840018 16:17394300-17394322 TGCAACGGTGATCGCTGCTGTGG - Intronic
1137519968 16:49184145-49184167 TGCCCAGGTGGTTGCTGCTGGGG + Intergenic
1138522086 16:57576811-57576833 TGCTCAGGTGGTGGGTGCTCAGG + Exonic
1140248200 16:73270478-73270500 TGACCCTGGGCTGGGTGCTGTGG - Intergenic
1140250439 16:73289915-73289937 TGCCCCCTTCAGGGGTGCTGAGG + Intergenic
1140766600 16:78165286-78165308 CACCTCTGTGATGGGTGCTGGGG + Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1141704227 16:85655799-85655821 TGCATCGCTGATGGGTGCAGTGG - Exonic
1142195514 16:88737614-88737636 AGCCTCGGTGTCGGGTGCTGTGG + Exonic
1142239067 16:88936857-88936879 TGCCCCGAGGGTGGGAGCTGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143119751 17:4599458-4599480 TGCCGCTGGGGTGGGTGCTGGGG - Intronic
1143146633 17:4780834-4780856 TGCTGTGGTGCTGGGTGCTGTGG + Exonic
1143462392 17:7112329-7112351 AGCCCGGGTGGTGGGGGCTGGGG - Intronic
1145191355 17:20843574-20843596 CGCCGCGGTGTTGGGGGCTGGGG + Intronic
1145934440 17:28706626-28706648 TTCCCAGGTGAGGGGTGATGAGG + Intronic
1146257598 17:31400597-31400619 CACCCAGGTGATGGGCGCTGGGG + Intronic
1147120225 17:38331234-38331256 TGCGCTGGTCATAGGTGCTGCGG + Exonic
1147671608 17:42180069-42180091 TGCCCCGGTGATGGGCGCTATGG + Intronic
1147863741 17:43539561-43539583 TAACCCTGTGCTGGGTGCTGGGG - Intronic
1148145962 17:45365011-45365033 TGGCCCTGTGCTTGGTGCTGTGG + Intergenic
1151977033 17:77488946-77488968 TGCCCTGCTGCTGGGTGCAGAGG + Intronic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1153293192 18:3521368-3521390 TGCCCTGCTGAAGGGGGCTGGGG - Intronic
1153448975 18:5205494-5205516 TGCCAGGGTGAGGGGTGGTGTGG + Intergenic
1155057841 18:22200661-22200683 TGCCCCGGTGATGACTGGTGCGG + Exonic
1157522797 18:48356873-48356895 GACCCAGGTGGTGGGTGCTGTGG - Intronic
1157697652 18:49735852-49735874 TGCCCTGTTGGTCGGTGCTGTGG - Intergenic
1158428494 18:57361381-57361403 TGCCCAGGTGACTAGTGCTGAGG + Exonic
1160510302 18:79449766-79449788 AGCCCCGGGGGTGGGTGCAGAGG + Intronic
1160541604 18:79627023-79627045 TGGCCCGGTGATGTGTCCGGCGG - Intergenic
1160553630 18:79712203-79712225 GGCCCCAGTGGTGGGTACTGTGG + Intronic
1160747890 19:720277-720299 CGCCCCGGTGATGGATGGAGGGG - Intronic
1160994845 19:1877848-1877870 CGCCACGGTGTTGGGGGCTGGGG - Intronic
1161356981 19:3824617-3824639 TGGCCTGGTGCCGGGTGCTGGGG - Intronic
1161689025 19:5720073-5720095 CGGCGCGGTGCTGGGTGCTGCGG - Exonic
1162081450 19:8220251-8220273 AGCCTCGGGGAGGGGTGCTGAGG - Intronic
1162418998 19:10555197-10555219 TGCCCCTGTGTTGGGTGCTCTGG + Intronic
1163667602 19:18610597-18610619 GGCGCCGGTGGTGGTTGCTGAGG - Intronic
1164402201 19:27910072-27910094 TGCCACGGTGGAGGGGGCTGGGG - Intergenic
1164720793 19:30430368-30430390 TGGCTCTGTGTTGGGTGCTGGGG + Intronic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1166061686 19:40329573-40329595 TGCCTGGGTGCTGGGTGCTTGGG - Intronic
1166154796 19:40902883-40902905 TACCCAGGAGATGGGTGGTGTGG - Intergenic
1166173279 19:41047438-41047460 TACCCAGGAGATGGGTGGTGTGG + Intergenic
1166264514 19:41670572-41670594 TGCCCAGGTGATGTGTGCATAGG + Intronic
1166903655 19:46087416-46087438 GGCCCCTTTGATGGGTGCTCAGG + Intergenic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
1167503511 19:49860075-49860097 TGCCCTGGTCATGGGGGATGAGG - Exonic
1167695475 19:51013254-51013276 AGGCCCAGTGCTGGGTGCTGGGG - Exonic
925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG + Intronic
925594610 2:5543091-5543113 AGCCCCCATGATGGGTGATGTGG + Intergenic
925730975 2:6918984-6919006 TGCCCCAGTGAATGGGGCTGGGG + Intronic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
929498002 2:42463565-42463587 TGCCCTGGTGCTGGGTTATGAGG - Intronic
929919306 2:46161188-46161210 TGCCCCATTGCTGGGGGCTGAGG + Intronic
929997972 2:46840879-46840901 TGTCCCAGTGATGGGTTGTGAGG + Intronic
930604265 2:53476433-53476455 TGCCACTGTGCTTGGTGCTGGGG - Intergenic
933758633 2:85659883-85659905 TGCCCCAGTGATGACAGCTGGGG - Intronic
935189148 2:100761953-100761975 TGTCAAGGTGATGGGTGATGGGG - Intergenic
936105396 2:109619580-109619602 TCCCACTGTGATGGCTGCTGGGG + Intergenic
936751564 2:115648517-115648539 TACCCAGGTGATGGGTTCTTAGG + Intronic
937361795 2:121234860-121234882 TCCCCCGCTGAGGGGAGCTGTGG - Intronic
938291891 2:130154964-130154986 GGCCCCGGCAAAGGGTGCTGTGG - Intronic
938464659 2:131518000-131518022 GGCCCCGGCAAAGGGTGCTGTGG + Intergenic
939986724 2:148836105-148836127 TGGTCCAGTGATGAGTGCTGGGG - Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
944857486 2:203782232-203782254 TGCTTTGGTGTTGGGTGCTGAGG + Intergenic
947136496 2:226981268-226981290 TGCCGAGTTGATGGGTGCAGCGG + Intronic
947566676 2:231198630-231198652 TGCCCGGGTGACGGCTGCGGAGG + Exonic
948553671 2:238792793-238792815 TGCCACAATGGTGGGTGCTGGGG - Intergenic
948607289 2:239144132-239144154 TGCTCAGTTGATGGGTGCTCTGG + Intronic
1168837033 20:884406-884428 AGGCCCAGTGCTGGGTGCTGGGG - Intronic
1169193640 20:3672331-3672353 TGCGCAGGTGACGGGTGGTGGGG + Intronic
1169875591 20:10293804-10293826 TGCCTCTGTGTTGGGTGCAGTGG - Intronic
1170868494 20:20182546-20182568 TGCCCGTGTTTTGGGTGCTGGGG - Intronic
1175645034 20:60663854-60663876 GGCCTCGGGGAAGGGTGCTGGGG + Intergenic
1175893351 20:62325028-62325050 TGACCCAGTGGTGGGGGCTGGGG + Intronic
1175895048 20:62332464-62332486 TGCCCCGGCACAGGGTGCTGTGG + Exonic
1176359205 21:5980263-5980285 TGCTCTGGTGTTGGGTGCTCTGG + Intergenic
1178916305 21:36707421-36707443 TGCCCCCGTGGTGGAGGCTGGGG + Intronic
1179049394 21:37875715-37875737 TGACCCTGAGATGGCTGCTGTGG - Intronic
1179764313 21:43558287-43558309 TGCTCTGGTGTTGGGTGCTCTGG - Intronic
1179813060 21:43884570-43884592 TGCCCTGGTGCTGGATGCAGGGG + Intronic
1180172676 21:46067897-46067919 TGCCCGGGTGATAGCTGCTGCGG - Intergenic
1181120903 22:20668381-20668403 CGCCGCGGTGTTGGGGGCTGGGG - Intergenic
1182150861 22:28026222-28026244 TGCCACGTTGAGGGGTGCAGAGG - Intronic
1183987060 22:41575722-41575744 TGCCCGGCTGACGGCTGCTGTGG + Exonic
1185275301 22:49948035-49948057 CGCCCTGGTGAGGGGTGCAGGGG + Intergenic
949639473 3:6019087-6019109 TGCCCTGGGGATGGTTGCTCAGG - Intergenic
950101528 3:10359824-10359846 TGCCCTGGTGCAGGGAGCTGGGG - Intronic
950432365 3:12958225-12958247 TGCCCCTGTGCTGGGTGCTGTGG - Intronic
953755515 3:45642894-45642916 TGCCGTGGAGATGAGTGCTGTGG + Intronic
955233461 3:57119917-57119939 TGCCCCAGTGCAGGGTGCTAGGG - Intronic
955344591 3:58151753-58151775 AGCCCTGATGATGGGAGCTGAGG - Intronic
958575861 3:95949433-95949455 TAGCCCGGTGGTGGGGGCTGTGG + Intergenic
961169680 3:124788188-124788210 TCCCCCGGGGCTGGGTGCAGTGG - Intronic
962746245 3:138399098-138399120 GGCCCTGGTAAGGGGTGCTGAGG - Intronic
967839734 3:193995498-193995520 TGGCCCGGTGAAGAGAGCTGGGG - Intergenic
968234231 3:197022332-197022354 TGTCCCGCTCAGGGGTGCTGAGG + Intronic
968481667 4:835733-835755 GCCCCCGGTGATGTGAGCTGGGG - Intergenic
968744550 4:2352954-2352976 TGCCCAGGGGACAGGTGCTGGGG - Intronic
968871345 4:3244233-3244255 TGCCCTGCAGATGGGAGCTGTGG + Intergenic
968903000 4:3439918-3439940 CGGCCTGGTGCTGGGTGCTGGGG + Intergenic
969231472 4:5834798-5834820 TTCCCTGGAGATGGGGGCTGTGG + Intronic
973945265 4:55948877-55948899 TGCCCCGGTAACGGGAGCGGCGG - Intronic
976858311 4:89630551-89630573 TGGCCAGGTGATGGGTATTGCGG - Intergenic
984920989 4:184764321-184764343 AGCCTCTGTGATGGGTGCTTAGG - Intronic
985151279 4:186949283-186949305 TGGACCTGTGATGGGAGCTGAGG + Intergenic
987031621 5:13981350-13981372 AGGCACGGTGCTGGGTGCTGGGG - Intergenic
988153265 5:27415347-27415369 TGCCCTGTTGATTGGTGATGTGG + Intergenic
990209901 5:53471192-53471214 TGGCCAGGTGCTGGGTGCAGTGG - Intergenic
993421652 5:87709441-87709463 AGCCCAGCTGATGGGTGCCGAGG - Intergenic
997998461 5:138605321-138605343 TGCCCTGGTGCTGAGTGGTGTGG - Intergenic
999342335 5:150782859-150782881 AGGCCCTGTGATAGGTGCTGAGG + Intronic
999456750 5:151723267-151723289 TGCCCTGGTGCAGGGTTCTGAGG - Intergenic
1001399072 5:171436086-171436108 TGCCCAGGTGCTGGTTGCCGAGG + Exonic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002187643 5:177462005-177462027 GGCCCCGGTGATGGCTGCTCCGG - Intronic
1004427616 6:15517020-15517042 GGCCCGGGTGGTGGGTGCTGGGG + Intronic
1006088087 6:31611043-31611065 TGCCCAGGTGATGAAAGCTGGGG + Intergenic
1006446813 6:34084345-34084367 TGCCCCACTGATGGCTCCTGAGG - Intronic
1007302975 6:40882328-40882350 AACCCCTGTGATGTGTGCTGAGG - Intergenic
1007413554 6:41678995-41679017 TGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1012451218 6:99354039-99354061 TGCCCAAGTGCTGGGAGCTGAGG + Intergenic
1014380155 6:120729879-120729901 TGCCTTGGGGATGGTTGCTGTGG + Intergenic
1015142368 6:129949668-129949690 TGCCCCTGTGATGCTTGCTTTGG + Intergenic
1017617922 6:156264927-156264949 TGACCCCCTGGTGGGTGCTGTGG + Intergenic
1018724845 6:166603851-166603873 TGCCCGTTTGGTGGGTGCTGAGG - Intronic
1019366973 7:638369-638391 AGCCCCAGTGAAGGGAGCTGGGG - Intronic
1019656177 7:2197352-2197374 AGGCCTGGTGCTGGGTGCTGGGG - Intronic
1019716423 7:2541462-2541484 GGCCACGGTGAAGGGCGCTGGGG + Exonic
1022180099 7:27910775-27910797 GGCCCGGGTGTTGGGTGCAGAGG - Intronic
1022652155 7:32287385-32287407 TTCCCTGGTGAAGGGTGTTGGGG - Intronic
1023861432 7:44219702-44219724 TCCCCAGGTGGTGGGTGCAGCGG - Intronic
1023912899 7:44568025-44568047 AGCCCCTGTGCTTGGTGCTGGGG - Intronic
1026679073 7:72451538-72451560 CTCCCTGGTGATGGATGCTGTGG - Intergenic
1026804868 7:73423576-73423598 TGCCCCAGTGATGTGTGCCGGGG - Intergenic
1030128630 7:106178493-106178515 TTCCCTGCTGATGTGTGCTGTGG + Intergenic
1032264324 7:130360288-130360310 GGCCCCAGCCATGGGTGCTGGGG + Intronic
1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG + Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034893156 7:154858162-154858184 TGCTCCGGGGCAGGGTGCTGTGG + Intronic
1035125693 7:156607011-156607033 TGGCCAGGTGATGGGGGGTGGGG - Intergenic
1037821124 8:22135023-22135045 TGGCCCTGTGCTGGGCGCTGGGG + Intergenic
1038612567 8:29069607-29069629 TGCCCAGGTGGAGGGTCCTGGGG - Exonic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1042268871 8:66936045-66936067 TGCTGAGGTGTTGGGTGCTGGGG - Intergenic
1046052947 8:109044909-109044931 TGGGCCGGTGATGGGTGGGGGGG + Intergenic
1046496296 8:115018927-115018949 GGCCCCAGTGATAGCTGCTGTGG + Intergenic
1048890018 8:138938675-138938697 AGCCCCAGTGTTAGGTGCTGGGG - Intergenic
1049092223 8:140524824-140524846 TGCCCTGCTGGTTGGTGCTGTGG + Intergenic
1049270836 8:141695355-141695377 TGCCCAGGTGGTGGGGGTTGGGG - Intergenic
1049749291 8:144275811-144275833 TGCCCCTGTCGTGTGTGCTGTGG - Intronic
1052115981 9:24648966-24648988 TGCCCAGGTCATTTGTGCTGAGG - Intergenic
1054808254 9:69413019-69413041 AGCCACGGTGCTGGGAGCTGCGG - Intergenic
1055474025 9:76643607-76643629 TGCCCCGCTGAGAGCTGCTGTGG - Intronic
1057822285 9:98341996-98342018 GGCACTGGTGGTGGGTGCTGGGG + Intronic
1058651241 9:107177190-107177212 AGACCAGGTGATGGGGGCTGGGG + Intergenic
1059312427 9:113397473-113397495 TGCCCCTGTGTTAGGTGATGGGG - Intronic
1059569338 9:115417560-115417582 TGCTCTGATGATGGGTTCTGGGG - Intergenic
1060153758 9:121304821-121304843 AGGCCCTGTGATGGGTGCTGGGG + Intronic
1060516361 9:124268353-124268375 TGGCCTGGTGCTGGGTACTGGGG + Intronic
1060959235 9:127667630-127667652 TTCCCATGTGATTGGTGCTGAGG + Intronic
1062619042 9:137411339-137411361 TGCTCCGGAGATGGGCTCTGAGG + Intronic
1185527346 X:790125-790147 AGCCCCGATGATGGATGCTCAGG + Intergenic
1187685869 X:21815043-21815065 GGCCCCGGTGAGGAGTGGTGAGG - Intergenic
1189284374 X:39841021-39841043 TGGCCCGGAGTCGGGTGCTGTGG + Intergenic
1190931035 X:54949967-54949989 TGGCCCTGTGCTGGGTGCTGGGG + Intronic
1192578781 X:72263755-72263777 TGCCCATGTGAGGGGTACTGAGG + Intronic
1192588396 X:72339291-72339313 AGGCCCTGTGCTGGGTGCTGGGG + Intronic
1195570218 X:106392285-106392307 TGACACTGTGATGGATGCTGGGG - Intergenic
1196089760 X:111727009-111727031 TGTCTCGGAGATGGATGCTGAGG - Exonic