ID: 1034387017

View in Genome Browser
Species Human (GRCh38)
Location 7:150748418-150748440
Sequence CAGTGTGAACAATCCATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034387017_1034387022 25 Left 1034387017 7:150748418-150748440 CCATACATGGATTGTTCACACTG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1034387022 7:150748466-150748488 AGCATCACATTTTACAGATGAGG 0: 1
1: 3
2: 55
3: 346
4: 1601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034387017 Original CRISPR CAGTGTGAACAATCCATGTA TGG (reversed) Intronic
901084897 1:6604314-6604336 CTGTGTGAACAGTCCTTCTATGG - Intronic
904300208 1:29549290-29549312 AAGTGGGGACACTCCATGTAGGG - Intergenic
912056156 1:105600740-105600762 CAGTGTTAACTACCCATCTATGG - Intergenic
918521913 1:185423959-185423981 CACTGTGAAGAATCCATGGTGGG + Intergenic
920270004 1:204755628-204755650 CAGTGTCAATAATCCTTGAAAGG - Intergenic
920276090 1:204805639-204805661 AAGTGTGCACAATCTAAGTATGG - Intergenic
923909658 1:238426949-238426971 CAGTGAGAACAAACAATGTTTGG + Intergenic
924250107 1:242124054-242124076 AAGTCTGAAAAATCAATGTAGGG + Intronic
1068707938 10:60097805-60097827 GAGTGTGAATAGTCCATGGAAGG + Intronic
1069126968 10:64647588-64647610 TAGTGTGAACAACACATTTAAGG + Intergenic
1069455893 10:68553502-68553524 CAGTGTGCACAGTCAAGGTACGG + Intergenic
1069576450 10:69533423-69533445 CAGTGAGAACAAACGATGTTTGG - Intergenic
1071084163 10:81848830-81848852 CAGTGTGATAAATCCATTAAGGG + Intergenic
1072848683 10:98861990-98862012 CAAGGTGAAAAATCCATGTTTGG + Intronic
1072955038 10:99880677-99880699 CAATGAAAACAATCCATGTCTGG + Intronic
1074291107 10:112138585-112138607 CAGTGTGCCCTATCCCTGTATGG + Intergenic
1074507510 10:114084668-114084690 TATTGTGAACTATGCATGTAAGG - Intergenic
1077838005 11:5941544-5941566 AAGTGTGAATAATTCATATAAGG + Intergenic
1081195734 11:40158171-40158193 CAGTGAGAACATACGATGTATGG - Intronic
1081418272 11:42841326-42841348 CAGTGTGAAGAAGCCACCTATGG + Intergenic
1081436912 11:43036838-43036860 CTGTGTGAAAAATGGATGTAAGG + Intergenic
1085455479 11:76662989-76663011 CAGTGTGAAGAGTTCATGTGTGG - Intronic
1086740376 11:90360778-90360800 CAGAGTGAACAGACAATGTACGG - Intergenic
1090692995 11:129204568-129204590 CAGAGTGAACTATACAGGTAAGG - Intronic
1095393211 12:41733526-41733548 CAGTGAGAACATGCCATGTTTGG + Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1097389500 12:58992725-58992747 CAGTGAGAACATGCCATGTTTGG + Intergenic
1099306737 12:80966274-80966296 CATTGTGAACAGTGCATGTGAGG + Intronic
1105588548 13:21768259-21768281 CAGTGGAAAAAATCCATGGAAGG + Intergenic
1106903090 13:34375752-34375774 CAGTGTCAACAATCATTGTCAGG - Intergenic
1108074537 13:46666166-46666188 CAGTGTAAACAAGACATATATGG + Intronic
1111732810 13:92098473-92098495 CAATGTGAACAGACCATTTAAGG + Intronic
1121265323 14:92598646-92598668 CAGTGTTAACAACTCATGTTGGG - Intronic
1127285150 15:57526221-57526243 CAGTGAGAAAAATCCAGGAAGGG - Intronic
1128703868 15:69823753-69823775 CAGTGTAAAAAATCCGTGTGTGG + Intergenic
1129039288 15:72671605-72671627 CAGTGGGAACTCTCCATGTAAGG - Intergenic
1130369076 15:83268147-83268169 CAGTGTGACCAATGCAAGCATGG - Exonic
1140873526 16:79128802-79128824 CATTGTGAACAAAATATGTAAGG - Intronic
1153378558 18:4410064-4410086 CAGTGAGAACATACCATGTTTGG - Intronic
1154352620 18:13598921-13598943 CAGGGTGGAAATTCCATGTAAGG - Intronic
1159346595 18:67214847-67214869 CAGTGTGTTCAATACATTTATGG + Intergenic
1163301250 19:16448228-16448250 CACTGTGAAAGAGCCATGTAAGG + Intronic
1164047627 19:21555949-21555971 CAGTGGGTACAACCCATGGAGGG - Intronic
931675628 2:64693369-64693391 TGGTTTAAACAATCCATGTAAGG - Intronic
932467079 2:71930842-71930864 CAGCCTGAAAAGTCCATGTAGGG - Intergenic
932633894 2:73371174-73371196 CAGTGAGAACAGCCCATGCAAGG + Intergenic
935106212 2:100046147-100046169 CAGAATTAACAATGCATGTAAGG + Intronic
935408824 2:102737339-102737361 CAATGTGAACAAACCATAGATGG + Intronic
938797730 2:134732209-134732231 CAGTGAGAACATACCATGTTTGG + Intergenic
939525073 2:143282933-143282955 CAGTGAAAACAATCCTTGTTGGG + Intronic
941277968 2:163514592-163514614 CAGTGTGAGGAATCTATGTCTGG + Intergenic
943044373 2:182841723-182841745 CATTGTGAACAATCAAAGAAGGG + Intronic
943405923 2:187484879-187484901 CAGTGTGAACGTTTCAAGTATGG - Exonic
1177324323 21:19564143-19564165 CAGCGTGAACAAACAATTTAGGG - Intergenic
1180025596 21:45159757-45159779 CAGTGTGAACAAGGTATGTCAGG + Intronic
1182195702 22:28514560-28514582 AAGAGTGAACACTCCGTGTAAGG - Intronic
1182310043 22:29397945-29397967 AAGTGGGAAGAATCCATGGAAGG + Intronic
1183975459 22:41509356-41509378 CAGTGTGAACAAGTCAGGCAGGG + Intronic
949384510 3:3485341-3485363 GAGATTGAACAATCCATGTAAGG - Intergenic
951411994 3:22376953-22376975 CAGAATGAACAAAACATGTAGGG + Intergenic
954423349 3:50430391-50430413 CAGTGTGAACAATCTCTTGAAGG - Intronic
954591959 3:51790480-51790502 CAGTGTGTACTATCTATGGATGG - Intergenic
956209402 3:66787751-66787773 CAGCCAGAACAAACCATGTAGGG + Intergenic
958969426 3:100594966-100594988 CAGTGAGAACAAACAATGTTTGG + Intergenic
959179288 3:102958032-102958054 ATGACTGAACAATCCATGTATGG + Intergenic
959878240 3:111412325-111412347 CAGTGAGAACAAACAATGTTTGG - Intronic
963624845 3:147658495-147658517 CACTGTGAACTGTCCATGTGAGG - Intergenic
964232398 3:154486624-154486646 CAGTGGGTACAAACCATGGAGGG + Intergenic
964537716 3:157742830-157742852 CAGTGAGAACATTCGATGTTTGG + Intergenic
969308940 4:6340901-6340923 CAGTGGGAACAGCCCATGTGAGG - Intronic
971360977 4:25938205-25938227 CAGTGTGAACAAAACAGCTAGGG + Intergenic
972178801 4:36440104-36440126 CAGTGTGTACAGCCCATGGAGGG - Intergenic
973112460 4:46412776-46412798 CAGTGTTAACATTCCATCCAGGG + Intronic
974433383 4:61827368-61827390 CAGTGTGAACAACTGATGTGGGG + Intronic
978394225 4:108261153-108261175 TAGTGGGAATAACCCATGTATGG - Intergenic
980314114 4:131174158-131174180 CAGTTTGAACAATCCGTGACAGG - Intergenic
981400399 4:144307354-144307376 CAGTGAGAACATACCATGTGTGG + Intergenic
988381758 5:30505709-30505731 CATTGTGAACAATCTATGGATGG - Intergenic
992516666 5:77501028-77501050 CAGTGGGCACAACCCATGTAGGG + Intronic
994997893 5:107087668-107087690 CAATGTGAAGATTTCATGTAAGG + Intergenic
995979843 5:118088235-118088257 TATTGTGAACTATGCATGTAAGG + Intergenic
996724961 5:126666318-126666340 CACTGAGAACAAGCCATGAATGG + Intergenic
996863222 5:128088357-128088379 CAGAGTGAAAAATCAAAGTATGG + Intronic
997099489 5:130953297-130953319 CTGTGAGATCACTCCATGTAAGG + Intergenic
998721372 5:144954551-144954573 CAGTGAGATAAATCCAAGTAGGG - Intergenic
1005191061 6:23225329-23225351 CAGTGAGAACACACCATGTTTGG + Intergenic
1005871325 6:29976113-29976135 CAGTGTAAATAATCCCTCTAAGG - Intergenic
1008220608 6:48850109-48850131 CAGTGTGAACATACGATGTTTGG - Intergenic
1012270031 6:97197759-97197781 CAGTGTGAACAAAATATTTATGG + Intronic
1012981482 6:105834863-105834885 CAGTGTGAACGATCCATCTGAGG - Intergenic
1013008130 6:106094122-106094144 CACTGTGAACAATCTGTGCATGG + Intronic
1014851506 6:126344690-126344712 CAATATGAACAATCTATGAAAGG - Intronic
1015823364 6:137286183-137286205 CATTGTGAAGAATGCATTTAAGG - Intergenic
1016971854 6:149771239-149771261 GATTGTGGAGAATCCATGTATGG - Exonic
1017109637 6:150920097-150920119 CAGTGTGAGCAATCCAAGGGAGG + Intronic
1017152337 6:151291692-151291714 CATTGTGGAGAATCCATTTAGGG - Intronic
1018407872 6:163506363-163506385 CAGTCAGTAAAATCCATGTATGG + Intronic
1018512515 6:164540658-164540680 CATTGTGAACAATGCATGCGAGG + Intergenic
1021498918 7:21307854-21307876 CATTGTGAACAATGCATGTGAGG - Intergenic
1021909274 7:25368263-25368285 CAGTGTGGAAAAGCCAAGTAGGG - Intergenic
1024086113 7:45892957-45892979 CAGTGTGAGACATCCATGGATGG + Exonic
1024716447 7:52085186-52085208 CAATGTGTACATTCCATGTATGG - Intergenic
1025977398 7:66379655-66379677 CATTGTGAACCATGCATGTGAGG - Intronic
1027800476 7:82743990-82744012 CAGAGTGCACAATGCCTGTAAGG + Intergenic
1028848304 7:95507982-95508004 AAGTGTGAACAAGCCTTTTAAGG + Intronic
1028877799 7:95843067-95843089 CAATGTGTAGAATACATGTAAGG - Intronic
1030108146 7:106004286-106004308 CAGTGTGAAAAATCCTAGAAGGG + Intronic
1031049671 7:116932243-116932265 TAGGGTCAACAATCTATGTATGG + Intergenic
1034387017 7:150748418-150748440 CAGTGTGAACAATCCATGTATGG - Intronic
1035846042 8:2865359-2865381 CAGGGTCAACAAGCCATTTATGG + Intergenic
1036595830 8:10211212-10211234 CAGTGTGAAAAATGCATGAATGG + Intronic
1039659395 8:39446730-39446752 CAGTTTGAACAATTCATTTAAGG + Intergenic
1042616468 8:70655115-70655137 CAGTGAGAACAAACAATGTTTGG + Intronic
1043010876 8:74880104-74880126 CTGTCTGAACAGTCCATGTAAGG + Intergenic
1044365508 8:91340722-91340744 CATTGTGAACAATCAATGTCAGG - Intronic
1044866213 8:96573700-96573722 CAGTGTGATCCATCCAATTATGG - Intronic
1045586089 8:103538863-103538885 CAGTGAGAACATACCATGTTTGG + Intronic
1050575804 9:6994121-6994143 TATTGTGAACCATGCATGTAAGG - Intronic
1052322039 9:27177905-27177927 CAGAGTGAAGAAACAATGTATGG - Intronic
1052454527 9:28678296-28678318 CAGTGCCAACAGCCCATGTAAGG - Intergenic
1057118839 9:92551755-92551777 CAGTGAGAACATTCGATGTTTGG + Intronic
1057973419 9:99579005-99579027 AAGAGTGAATAATCCAAGTAAGG - Intergenic
1058631043 9:106986847-106986869 CAGTGAGAACATACCATGTTTGG + Intronic
1186651833 X:11569508-11569530 TAATGTGTAAAATCCATGTAAGG + Intronic
1187636344 X:21233065-21233087 CAGTGAGAACAAACGATGTTTGG + Intergenic
1192068627 X:67913228-67913250 CAGTGTGAACATACGATGTTTGG + Intergenic
1193544906 X:82814551-82814573 CACTGTTAACAAACCATGTGAGG - Intergenic
1194031183 X:88817669-88817691 CAGTGAGAACATACAATGTATGG - Intergenic
1194160374 X:90442154-90442176 CATTGTTAACAGTACATGTAAGG - Intergenic
1195162436 X:102183772-102183794 CAATTTGAACAATGCATGTATGG + Intergenic
1198510558 X:137346635-137346657 CAGTGAGAACATACCATGTTTGG + Intergenic
1198781740 X:140245112-140245134 CAGTGTGAACATACGATGTTCGG + Intergenic
1200506664 Y:4019102-4019124 CATTGTTAACAGTACATGTAAGG - Intergenic