ID: 1034392074

View in Genome Browser
Species Human (GRCh38)
Location 7:150794573-150794595
Sequence CTGAAGACACACACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034392066_1034392074 20 Left 1034392066 7:150794530-150794552 CCTGCAGTTGTCAGCTCCTTCAG 0: 1
1: 0
2: 9
3: 51
4: 275
Right 1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 329
1034392069_1034392074 4 Left 1034392069 7:150794546-150794568 CCTTCAGGGTCACCCTAATTTTT 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 329
1034392070_1034392074 -8 Left 1034392070 7:150794558-150794580 CCCTAATTTTTCAAGCTGAAGAC 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 329
1034392071_1034392074 -9 Left 1034392071 7:150794559-150794581 CCTAATTTTTCAAGCTGAAGACA 0: 1
1: 0
2: 2
3: 37
4: 511
Right 1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034392074 Original CRISPR CTGAAGACACACACTGAGGA GGG Intronic
900530945 1:3152917-3152939 CAGAAGACAGGCTCTGAGGACGG + Intronic
900878322 1:5362165-5362187 CGGAGGACTCACACAGAGGAAGG - Intergenic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
901593580 1:10367019-10367041 GTGAAGAGATACACTGAGGAAGG + Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
902995541 1:20222190-20222212 TTGAAGACACACACTGTGTCAGG + Intergenic
903085144 1:20850123-20850145 CGAAAGACACAAACTGAGAAAGG - Intronic
903918880 1:26785456-26785478 TTGAAGACACACAGTGTGCAAGG + Intergenic
904698289 1:32342828-32342850 CTGAAGTCACACAGTGGTGATGG - Intergenic
906822544 1:48944648-48944670 CAGAAAACACAGGCTGAGGAAGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907492212 1:54815455-54815477 CCCAAGACAAACACAGAGGATGG - Intronic
909546798 1:76857341-76857363 ATGACGGCACACATTGAGGAAGG - Intergenic
910286276 1:85557826-85557848 CTGAAGACACAAACAGAAGGTGG + Intronic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
910977412 1:92921301-92921323 CTATAGAAACACACTCAGGATGG + Intronic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
915377769 1:155412536-155412558 ATGAAGACATATACTGGGGAAGG - Intronic
916417630 1:164607476-164607498 CTGAAGAAAGCTACTGAGGAAGG + Intronic
917496526 1:175545476-175545498 TTGAAACCACAGACTGAGGAGGG + Intronic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
918270905 1:182898331-182898353 CTGAAGCCAAAAACTGAGAAAGG + Intergenic
919042302 1:192405803-192405825 CTTAAGAGCCACACTGTGGAAGG + Intergenic
919584004 1:199413460-199413482 GTGCCTACACACACTGAGGAGGG - Intergenic
919768046 1:201139996-201140018 CGGAACAGACACACTGATGAGGG - Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
920170015 1:204066067-204066089 CTGAACCCACACACTGAGTGGGG + Intergenic
922054153 1:222024067-222024089 CTGAAGACCCACACTGGGGGTGG + Intergenic
922124732 1:222711748-222711770 AGGAAGACACACACAGAGCAAGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
924010948 1:239664801-239664823 AGGAAGACCCACACTGAGAACGG - Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924750031 1:246878591-246878613 CTGAAGATATACACTAAGAATGG + Intronic
1063218941 10:3948636-3948658 CTGAAGACACAAACTACTGATGG + Intergenic
1064267054 10:13833582-13833604 CTGAAGCCACACAGTCAGTAAGG - Intronic
1065366178 10:24939052-24939074 CAGAAGTCACACAGTGAGGTGGG + Intronic
1065890775 10:30119289-30119311 CTGGAGACACTAACTGAGGTTGG - Intergenic
1066108683 10:32177741-32177763 CTGAAGTTACAAACTGAGGTTGG + Intergenic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1067726943 10:48777531-48777553 CTGAAGACTCATACTTTGGAAGG - Intronic
1067842489 10:49691987-49692009 CTGAAGACACTCCTGGAGGATGG - Intronic
1068372599 10:56137409-56137431 CAGAAATCACACAGTGAGGAAGG - Intergenic
1068796917 10:61093563-61093585 CTGATGAGAGACAGTGAGGAGGG + Intergenic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1073117469 10:101099671-101099693 ATGCACACACACAGTGAGGAAGG + Intronic
1073227597 10:101936538-101936560 CTTAGGAAACACTCTGAGGAAGG + Intronic
1073295526 10:102436145-102436167 CAGAACACGCACACTGAGAAGGG - Intergenic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1074559220 10:114520077-114520099 CTGAAGACTCCCACTGCAGAGGG + Intronic
1075785717 10:125048737-125048759 CGGAACACACACAGAGAGGACGG + Intronic
1076352432 10:129826186-129826208 CTGAGGACAAAGACTCAGGAGGG + Intergenic
1077968953 11:7167369-7167391 CTGAGGAGACATACAGAGGAGGG + Intergenic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1079400414 11:20102378-20102400 GTGAAGACACAGACTGGGGCAGG + Intronic
1081270739 11:41079199-41079221 CTGAAGATAGCCTCTGAGGAGGG + Intronic
1081653984 11:44845141-44845163 CTGAAGACTCACCCAGAGCAGGG + Intronic
1083021832 11:59515585-59515607 CTGAGGTCTCACACTGGGGAAGG + Exonic
1083023742 11:59532457-59532479 CTGAGGTCTCACACTGAGGAAGG + Intergenic
1083878150 11:65535544-65535566 CCGAAGTCACACAGTCAGGAGGG + Intronic
1085653410 11:78289752-78289774 ATGAACACAAACAATGAGGAAGG + Intronic
1086836159 11:91625734-91625756 CTGAACAAACACTCTTAGGAGGG + Intergenic
1086971560 11:93086312-93086334 AAGAAGCCACACACTAAGGATGG + Intergenic
1089199565 11:116715624-116715646 CAGGAGACAAACACTGAGGGTGG + Intergenic
1089321706 11:117630860-117630882 CTGAGGTCACACATTTAGGAAGG - Intronic
1090776218 11:129968423-129968445 CTGAGGACAAAAACGGAGGAGGG + Intronic
1091656743 12:2351644-2351666 CTGCAGACACACCCTGGGGAAGG - Intronic
1091843766 12:3638933-3638955 CTAAGGACACACAGTGAGTAAGG - Intronic
1091850410 12:3692714-3692736 CTGAACACCCACACAGAGGCAGG - Intronic
1091854167 12:3725447-3725469 ATAAAGAGACACACAGAGGAGGG - Intronic
1092655850 12:10684723-10684745 ATGCCCACACACACTGAGGAGGG + Intergenic
1095749501 12:45695711-45695733 CTGAAAGCAGACACTGAGAAAGG + Intergenic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096531957 12:52248147-52248169 CAGAGGACAGACAGTGAGGACGG - Intronic
1098352593 12:69580099-69580121 ATAAAGACACACACAAAGGAAGG + Intergenic
1101492376 12:105221731-105221753 CTGAAAGGACACCCTGAGGAGGG + Intronic
1102819403 12:115895115-115895137 ATGAAAACACACCCTGAGAAAGG - Intergenic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103347382 12:120260192-120260214 TTGGGGACACACACTCAGGATGG - Intronic
1103440942 12:120962573-120962595 CAGAAGCCACCCACTGAAGATGG + Intergenic
1103554333 12:121756956-121756978 CTGAGGACACTAGCTGAGGACGG + Intronic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1106966333 13:35074389-35074411 CTTAGGTCACACAATGAGGAAGG - Intronic
1107349579 13:39500099-39500121 TTGAAGAAACATACTGAGGCAGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107997243 13:45872961-45872983 CTCCAGTCACACACTGAAGAAGG + Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112379113 13:98871958-98871980 CTGAAGACCCACACTCAGCCTGG + Intronic
1112569429 13:100580354-100580376 CAGAAGACAGACACCGAGGAGGG + Intronic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1114816029 14:25959175-25959197 CTGATGACCCCCACAGAGGATGG - Intergenic
1115415832 14:33132308-33132330 CTGAAGAGACAAACTTAGGGAGG + Intronic
1116056240 14:39866855-39866877 ATGAAGACACACCCTAAGGTAGG - Intergenic
1117972935 14:61270169-61270191 CTGATGAAAGACACTGAGGTTGG + Intronic
1118002156 14:61533486-61533508 TTGAGGAGACACACTGAGGAGGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1120011766 14:79423620-79423642 CAGTAGACAAACACTGGGGAAGG - Intronic
1120747300 14:88164021-88164043 CAGAGGTCACACACAGAGGAAGG - Intergenic
1121086501 14:91150347-91150369 TTCAAGACACACACTGAGTCTGG + Intronic
1121496410 14:94394599-94394621 CTGGAGTCTAACACTGAGGAGGG + Intergenic
1122154468 14:99742022-99742044 CTGAGGTCACACACGAAGGAGGG - Intronic
1122701296 14:103590967-103590989 CTGACGACTCACAGTGAGGGTGG - Exonic
1123990873 15:25682424-25682446 CAGGAAACACACACTGGGGAAGG + Intronic
1125511060 15:40292542-40292564 CTGAAGTCACACAGCCAGGATGG - Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1128944385 15:71811188-71811210 CTGAAGCCACCCACAGAGAAGGG + Intronic
1129279723 15:74474799-74474821 CAAAAGACACACACTAAGGATGG + Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1133277037 16:4645272-4645294 CTCAGGACACTCACTGAGGCAGG - Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1135483569 16:22843837-22843859 CTGAAGACCCACAATCAGAAAGG + Intronic
1135830716 16:25770478-25770500 CTCAGGCCACACATTGAGGAAGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1138459504 16:57139825-57139847 CCCAAGTCACACAGTGAGGAAGG - Intronic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1139515542 16:67450428-67450450 CTCCACACACACACTGGGGATGG + Intronic
1140653119 16:77110049-77110071 CTGAAAACCCACTCTGTGGAAGG + Intergenic
1140814481 16:78608593-78608615 CTGCAGACCCATACTGTGGAAGG + Intronic
1143284978 17:5782206-5782228 TTGAAGACACACACCTAGGAAGG + Intronic
1145296570 17:21597878-21597900 CCCAAGACACACACATAGGAAGG + Intergenic
1145367208 17:22274199-22274221 CCCAAGACACACACATAGGAAGG - Intergenic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1147542548 17:41372801-41372823 TTGAAGTCCCACAATGAGGAAGG - Intronic
1148001556 17:44390520-44390542 ATGGAAACACACACTAAGGATGG + Intergenic
1148236367 17:45971867-45971889 CTGCAGACCCCCACTGAGGACGG + Exonic
1149848275 17:60020248-60020270 CTGTAGAAACTCACTCAGGAAGG + Intergenic
1149861894 17:60126276-60126298 CTGTAGAAACTCACTCAGGAAGG - Intergenic
1150086627 17:62276815-62276837 CTGTAGAAACTCACTCAGGAAGG + Intronic
1151537526 17:74747423-74747445 CTGAGGACAGACACTGAGGAAGG - Intergenic
1151571048 17:74925468-74925490 CTGAGGACAGGCCCTGAGGATGG - Intronic
1151868146 17:76818633-76818655 CTGATGGCAAACACTGAGGATGG - Intergenic
1152306136 17:79521063-79521085 CGGAAGACACGCAAAGAGGATGG + Intergenic
1152500558 17:80705865-80705887 GAGAGGACACACCCTGAGGAGGG - Intronic
1152581623 17:81167885-81167907 CTGAAGACACAGACTGAACGAGG - Intergenic
1152838735 17:82552531-82552553 CAGAAGACAAAGGCTGAGGATGG - Intronic
1153028226 18:690082-690104 CTGAAGAGACACACAGGGCAAGG - Intronic
1154087187 18:11318845-11318867 CTGAAGACAAAGTCTGAGGGTGG + Intergenic
1156157323 18:34318607-34318629 GTGCACACACACACTAAGGAAGG - Intergenic
1156931029 18:42643656-42643678 AAGAAGGTACACACTGAGGAGGG - Intergenic
1157480163 18:48048754-48048776 TTGAAGACACTCCCTGAGAAGGG + Intronic
1157543182 18:48526852-48526874 CGGAAACCACACACTGGGGAAGG + Intergenic
1157571099 18:48712888-48712910 CTGAACACATTCACAGAGGATGG + Intronic
1159019869 18:63134511-63134533 CTGAGAACACACACTGAGCTCGG - Intronic
1159149231 18:64498479-64498501 TTGAGGACACACATTGAAGAAGG - Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1159770077 18:72538811-72538833 ATGAAAACATACACCGAGGAGGG - Intronic
1161115244 19:2493091-2493113 CTGGAGACAGACACAGAGGTGGG + Intergenic
1161908187 19:7173243-7173265 CTGAATACTCACAGTGAGTAAGG - Intronic
1162310578 19:9904667-9904689 CTGAAGCCACACACTGGGGGTGG + Intronic
1164509168 19:28883419-28883441 CAGAGAACACACACTGAGGCAGG - Intergenic
1165354102 19:35293215-35293237 CTGCACACACACACTGAGGATGG - Intronic
1166945699 19:46394759-46394781 CTGAGGACACACAACTAGGAAGG + Intergenic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
925009977 2:476553-476575 ATGCAGACAGACACAGAGGAAGG + Intergenic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
926099248 2:10103528-10103550 CTGAAGGATCACACTTAGGATGG - Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
929246401 2:39708008-39708030 CTAAAGACACACAATGAATAAGG + Intronic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
933460224 2:82573757-82573779 CTGAAGACAAACAATGAAGGTGG - Intergenic
934755366 2:96820755-96820777 CTGCAGCCACACTCTGTGGAGGG - Intronic
934765976 2:96880273-96880295 CTGATGACAGACCCTGAGGGCGG + Intronic
935133871 2:100281488-100281510 ATGAGGACACACACGGGGGATGG + Exonic
935531284 2:104235179-104235201 ATGAAGACACACAAAGAAGAAGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936609063 2:113983877-113983899 CCGAAGACACTCACTCAGCATGG - Intergenic
937000177 2:118458588-118458610 CTGAGGACACCCCCTCAGGAGGG + Intergenic
939282475 2:140082083-140082105 CTGATGTAATACACTGAGGAAGG + Intergenic
939826962 2:147026568-147026590 CTGAAGACATAAGCTAAGGAAGG + Intergenic
939994166 2:148904762-148904784 CTGAAGAGAGTCACAGAGGAAGG + Intronic
940153684 2:150630341-150630363 ATGAAGACACACAGAAAGGAAGG + Intergenic
941112427 2:161429392-161429414 CCTAACACACAAACTGAGGATGG - Intronic
944355029 2:198777688-198777710 CTTCAGACACAGACTCAGGAGGG + Intergenic
944906704 2:204269131-204269153 CTCATGACACGCACTGTGGAGGG - Intergenic
945104871 2:206300520-206300542 CTGATGCTACACACTGAGAAGGG - Intronic
945219416 2:207468743-207468765 CTTAAGACTCACAGTCAGGAAGG + Intergenic
945523772 2:210862689-210862711 CTGAAGATTGACACTGAGGGAGG + Intergenic
945556765 2:211286540-211286562 CAAAGGACACAAACTGAGGAAGG - Intergenic
945887941 2:215396856-215396878 CTGAAGAAAAGCACTGTGGAAGG - Intronic
946176362 2:217924100-217924122 CCGAAGCCACACACAGAGGTGGG + Intronic
946324026 2:218973914-218973936 CTAAAGTCACACAGTGAGAAAGG - Intergenic
947032098 2:225807954-225807976 TGGAGGACACACCCTGAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169385616 20:5146886-5146908 TAGAAGCCACACACTCAGGAAGG - Intronic
1170509699 20:17063999-17064021 CTAAAGACACAAATTGAAGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1173951653 20:46998182-46998204 CTGGACAGACACACTGAGGGTGG - Intronic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1175328531 20:58146868-58146890 GTGAAGAAACTCACTGAGGGTGG + Intergenic
1175470794 20:59226063-59226085 CATAAGACCCACACTGATGATGG - Intronic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1177399866 21:20588463-20588485 ATGCAGACACACACCCAGGAGGG + Intergenic
1178037155 21:28597996-28598018 CTGAAAAGTTACACTGAGGAAGG + Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179447533 21:41443016-41443038 CTGAAGACAGACAGTGGTGATGG + Intronic
1181235266 22:21444705-21444727 CTGAGGACTCAAACTGAGAAGGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1183542506 22:38437581-38437603 CTGGAGAGACACACTCTGGATGG + Intronic
1183726707 22:39594003-39594025 CTGGGGAGACACACTGAAGATGG + Intronic
1185078500 22:48696168-48696190 CTGCACACCCACACTGAGGCTGG + Intronic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185271368 22:49930668-49930690 ACGCAGGCACACACTGAGGATGG + Intergenic
950420820 3:12898370-12898392 CTGAAGGAACACACTGAGTGCGG + Exonic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
952670904 3:35967082-35967104 GTGAAGTCACTCACTGAAGAGGG + Intergenic
953240738 3:41147322-41147344 ATGAGGACACACTCTGGGGATGG - Intergenic
954065784 3:48104820-48104842 CTGAAGACCCACAGTCAGAAAGG + Intergenic
955202650 3:56864806-56864828 ATCAAGACACTCTCTGAGGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956974425 3:74563831-74563853 CAGAAAACACACAATGAGAACGG - Intergenic
961212447 3:125136275-125136297 CAGCAGCCACACCCTGAGGAAGG + Intronic
962898329 3:139735722-139735744 CTGAGGACAAACACTGTGCAAGG + Intergenic
963052420 3:141153360-141153382 CGGGGGACACACACTGATGAAGG + Intergenic
963382102 3:144543463-144543485 CTGGAGACACACATTTGGGAAGG + Intergenic
965550225 3:169957075-169957097 CTGACAAGACACACTGAGAAGGG + Intergenic
965559736 3:170049801-170049823 TTGTGGACACACCCTGAGGAAGG - Intronic
965815238 3:172629379-172629401 GCGAAGAAACACACTCAGGAAGG + Intergenic
965858765 3:173121327-173121349 CTGAAAACACACATTGAGCGAGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966748364 3:183299494-183299516 CTCAAGACAACCTCTGAGGAAGG - Intronic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
968264426 3:197351699-197351721 CTGAAGACACACTGTGAACAAGG + Intergenic
968361150 3:198147860-198147882 CTGGAGACAGACACTGGGCAGGG - Intergenic
969706063 4:8792444-8792466 ATGGACACACACACAGAGGAAGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
972703875 4:41521170-41521192 TTGATGACACATACTGAGGTTGG + Intronic
973115688 4:46455528-46455550 CAGAAGTCACAATCTGAGGAAGG + Intronic
973729898 4:53813192-53813214 GGGAAGCCACACATTGAGGAGGG - Intronic
976549913 4:86381972-86381994 CTGTAGAGAAACCCTGAGGAGGG - Intronic
976708226 4:88041300-88041322 CTGAAGTCACTCAGTGAAGATGG - Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
977668192 4:99665315-99665337 CTGAAGGCATACAGAGAGGATGG - Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978919001 4:114159457-114159479 TTGAAGATATACACTGAGAAAGG + Intergenic
978941154 4:114437272-114437294 CTGATGACAAAAACAGAGGAAGG + Intergenic
982122352 4:152155411-152155433 CAAAAGCCACACACTAAGGAAGG + Intergenic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
982668415 4:158293153-158293175 CTGCTCACAGACACTGAGGAGGG - Intergenic
983168725 4:164511653-164511675 GTGAAGTCAGACTCTGAGGAAGG + Intergenic
985100574 4:186454242-186454264 CTGAAGAGACCCACAGAGAAAGG + Intronic
985309696 4:188583731-188583753 CTGAAAACACAAAATGAGCAGGG - Intergenic
985700925 5:1371990-1372012 CTTAAAACACACTCTCAGGATGG - Intergenic
986256422 5:6104583-6104605 TTGAAGAGACACACAGAGAAGGG + Intergenic
986430240 5:7674070-7674092 CTGACGACACACGCTGAGACTGG - Intronic
987658493 5:20839888-20839910 CTGAAGAGATACACTAAGTAAGG - Intergenic
987662738 5:20898284-20898306 CTGAAGACACACAGTTAGTGAGG + Intergenic
989985420 5:50691287-50691309 CTGAAGAGAAAACCTGAGGATGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
997310681 5:132878457-132878479 CTGAGGACACCTATTGAGGAGGG + Exonic
997374869 5:133390703-133390725 CTGAAGACACTCTCTGCTGATGG + Intronic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
999251489 5:150185009-150185031 CTGAAGTCAGACCCTGAGGGGGG - Intergenic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
1000527234 5:162372436-162372458 CTGAAGACTGGCCCTGAGGAGGG - Intergenic
1000862457 5:166472920-166472942 CTGAGGAGACACACTGAGACTGG + Intergenic
1001224498 5:169932201-169932223 CTGCACACACACACAGAGTAAGG + Intronic
1002392036 5:178921679-178921701 CTGAAAACAGGCACTGAGGCAGG - Intronic
1002423706 5:179163890-179163912 CTGAGGAGACTCCCTGAGGAGGG + Intronic
1003418360 6:5933748-5933770 ACGAGGACACACACTGAAGATGG - Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1007545685 6:42692247-42692269 CTAAAGCCAAACACTGAAGAAGG + Exonic
1007756724 6:44104287-44104309 CTGATGAGACACCCTGAGCAGGG + Intergenic
1012816007 6:104023378-104023400 CCCAAGCCCCACACTGAGGAGGG + Intergenic
1014344844 6:120255160-120255182 AAGAAGACACACAAAGAGGAGGG - Intergenic
1015699485 6:136020111-136020133 AAGAAGAGACACACTGAAGAGGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017234230 6:152102832-152102854 CTAAACACACACACTGACGATGG - Exonic
1017259325 6:152368856-152368878 CTGGAGACCCACACTGTGGGCGG + Intronic
1018135598 6:160775627-160775649 CTGAAGGCAGACTCTGATGAAGG + Intergenic
1018208614 6:161459063-161459085 CAGCAGACACTCTCTGAGGAAGG - Intronic
1018683766 6:166285914-166285936 CAGACGACACAAACTGTGGAGGG - Intergenic
1019254537 7:40861-40883 CTGGAGACAGACACTGGGCAGGG + Intergenic
1019340243 7:505475-505497 CTGCAGAGACCCCCTGAGGAGGG + Intronic
1021314503 7:19130597-19130619 TTGAAGACACATTCTGAGAATGG - Intergenic
1021550580 7:21867252-21867274 CTGAAGAAACACAATAGGGAAGG - Intronic
1021975387 7:26007024-26007046 CTGAAGACAAACACTGTAGTAGG + Intergenic
1022409693 7:30129331-30129353 TGGAAGCCACACACTAAGGACGG + Intronic
1022573944 7:31479810-31479832 CTCAGGTCACGCACTGAGGAAGG + Intergenic
1023113120 7:36834263-36834285 GTGAAGTCACACACAGAGGGAGG + Intergenic
1024561602 7:50649494-50649516 GTGACGACACACACGGGGGAGGG + Intronic
1024862106 7:53856762-53856784 CTGAAGAAATACAATGAGGCTGG - Intergenic
1024918171 7:54526243-54526265 GAGAAGAGACACACTGAAGAGGG - Intergenic
1027751195 7:82149076-82149098 CTGAGTACACAGACTGAGGCAGG - Intronic
1028577845 7:92371922-92371944 CTCAAGACTCTCACTGGGGAAGG - Intronic
1029463091 7:100707420-100707442 CCGCATACACACACTCAGGAAGG - Exonic
1030486643 7:110176995-110177017 CTAAAGACTCATACTGGGGAAGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031914146 7:127546497-127546519 CTGAAGATACACACAGTGGCAGG + Intergenic
1034110737 7:148535439-148535461 CTGAAGACAGAAACTGAACAGGG + Intergenic
1034129957 7:148706580-148706602 CTGAAGACACATACTGAAATTGG + Intronic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035599542 8:889511-889533 GGGAAGCCACCCACTGAGGAAGG + Intergenic
1036076225 8:5504142-5504164 CAGAAAACACATACTGGGGAAGG - Intergenic
1037928416 8:22863276-22863298 CTTAGGACACACAGAGAGGAAGG - Intronic
1037979319 8:23239642-23239664 CTCATGACACAGACTCAGGAAGG - Intergenic
1038075242 8:24065921-24065943 CTTAAGACACAAAATGAGCATGG - Intergenic
1038466498 8:27769669-27769691 CTCATGGCACACACTGTGGAAGG + Intronic
1039626021 8:39054057-39054079 CTGCACACATGCACTGAGGAAGG + Intronic
1039975666 8:42362755-42362777 ATGAAGTCACACACTCAGAATGG - Intronic
1041742609 8:61172805-61172827 CAGAAGGCACACACTAAAGATGG - Intronic
1042132630 8:65602946-65602968 CTCAAGACTCTCACTGATGATGG + Exonic
1042514885 8:69648579-69648601 ATAAATACAAACACTGAGGAAGG + Intronic
1042721610 8:71832786-71832808 CTGAAGACCCACAGTAAGCAGGG + Intronic
1043824074 8:84903512-84903534 CTGAACACACACACATATGAGGG + Intronic
1044454236 8:92374071-92374093 CTGATGTATCACACTGAGGATGG - Intergenic
1044770974 8:95633637-95633659 CTGAAGTCACACTCTTAGGCTGG + Intergenic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1045341208 8:101256075-101256097 CTGACGCCACACTCTGTGGAGGG - Intergenic
1046790571 8:118317291-118317313 CTGGTGACACATACTCAGGATGG - Intronic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047619102 8:126588188-126588210 TTGAAGACACACTATGAGGCAGG - Intergenic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048319337 8:133386221-133386243 CTGAAGACAGACTCTGAGGTAGG - Intergenic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1048639077 8:136332798-136332820 CTGAAGCCAGTCACTGATGAGGG + Intergenic
1049345491 8:142136504-142136526 GTGAAGGCACCCACAGAGGATGG - Intergenic
1051224350 9:14883243-14883265 CTGAAGCAACACAGTTAGGAGGG + Intronic
1051354594 9:16230429-16230451 CAGAAGACCAACACTGGGGAAGG + Intronic
1051513485 9:17905793-17905815 CAGAAGATACACACTGAGCTCGG - Intergenic
1051739463 9:20237532-20237554 CTGAAGACACAGACTAGAGAAGG + Intergenic
1052861051 9:33438048-33438070 GTGCACACACACACTGAGGCAGG + Intergenic
1052950180 9:34202443-34202465 CTTAAGACTCACAATGAGAAAGG + Intronic
1053128820 9:35604318-35604340 CGGAACCCTCACACTGAGGAGGG + Intergenic
1053589220 9:39494109-39494131 CCGAGGACACGCACTGGGGAAGG + Intergenic
1054577078 9:66871186-66871208 CCGAGGACACGCACTGGGGAAGG - Intronic
1054826675 9:69580431-69580453 CAGAGGACAGACACTGAGAAAGG + Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056808988 9:89749914-89749936 CTGAGGTCACACAGTGAGGATGG + Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057751155 9:97794346-97794368 CTAAAGACACCCACTAATGAGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1060333966 9:122704238-122704260 CTCAAGACACACCCTGATCAAGG - Intergenic
1061259248 9:129470627-129470649 CGGAAGGCAGACACTAAGGATGG + Intergenic
1061572254 9:131485035-131485057 CTGGAGGCACCCACAGAGGATGG - Exonic
1061935125 9:133853272-133853294 CTGGAGACCCACACTTGGGAAGG - Intronic
1062745862 9:138211692-138211714 CTGGAGACAGACACTGGGCAGGG - Intergenic
1186189085 X:7051761-7051783 AGGAAGACATACACTTAGGAAGG + Intronic
1186643821 X:11484993-11485015 CTGAAGACATTCACTGAGAATGG + Intronic
1190259363 X:48788190-48788212 CAGAAGACACACAATGAGACAGG + Intronic
1192495732 X:71615791-71615813 CTGCAGACAGACATTGATGAAGG + Intergenic
1192952495 X:76032133-76032155 CTGACGATACACCTTGAGGAGGG + Intergenic
1194049645 X:89053233-89053255 CAGAAGACACATATTGAGGCTGG - Intergenic
1196825640 X:119738199-119738221 CTCACAACACACAGTGAGGAAGG + Intergenic
1197717646 X:129720836-129720858 CTGCTGACACACAGTGAAGAGGG - Intergenic
1199137114 X:144266331-144266353 CTGAACACCCACACAGAGGCTGG + Intergenic
1200930701 Y:8694414-8694436 GTGAAGATACAAACTGATGAAGG - Intergenic