ID: 1034392436

View in Genome Browser
Species Human (GRCh38)
Location 7:150797238-150797260
Sequence ATGCTGCTATTTGTGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034392436 Original CRISPR ATGCTGCTATTTGTGGGAAA AGG (reversed) Intronic
903688572 1:25151925-25151947 ATGCTTGTATTTGTGGGGAGAGG + Intergenic
905322484 1:37127914-37127936 TGGCTGCTATCTGTTGGAAAAGG + Intergenic
906252020 1:44318106-44318128 CTGCTACTTTTTGTGGGAATGGG - Intronic
907514283 1:54983460-54983482 TTGCTGCTCATTGTGGAAAAAGG - Intronic
907758438 1:57334007-57334029 AAGCAGGTATTTGGGGGAAAGGG + Intronic
908399164 1:63754081-63754103 ATGCTACTTTATGTGGCAAAAGG + Intergenic
913711760 1:121491330-121491352 ATGCTGCCATCTGTGGAGAAGGG + Intergenic
918705177 1:187651608-187651630 ATACTTCTTTTTGTGGGCAAGGG + Intergenic
920801368 1:209190844-209190866 GTGCAGTTCTTTGTGGGAAAGGG + Intergenic
920968197 1:210719314-210719336 ATTCTGCTATTTGTAGGCATGGG + Intronic
921199608 1:212792301-212792323 ATGCCACTCTTTGTGGGAAGCGG + Intronic
922092998 1:222415316-222415338 ATGCTGCTGGTAATGGGAAATGG + Intergenic
923586066 1:235272241-235272263 ATGTTGGTATATTTGGGAAAAGG - Intronic
923622420 1:235589368-235589390 ATGCAGCTATGTGTGGGAGCTGG + Intronic
924906406 1:248457581-248457603 ATGCTGCTAAGTGTGTGACATGG - Intergenic
924921481 1:248634460-248634482 ATGCTGCTAAGTGTGTGACATGG + Intergenic
1063482981 10:6392830-6392852 AGGCTGCTGTTTGTTAGAAAAGG + Intergenic
1064655340 10:17550686-17550708 ATGCAGAAATTTCTGGGAAAAGG + Intergenic
1066165997 10:32788788-32788810 ATCTTGTTATTTGTGGGAACTGG - Intronic
1070930884 10:80259850-80259872 ATGCTCCTCTTTTTGGGAGAGGG - Intergenic
1071359342 10:84830267-84830289 ATGTTACTATTTATGAGAAAAGG + Intergenic
1072751789 10:97986054-97986076 AAGCTGCAATGTGTGGGAAAAGG + Intronic
1073197326 10:101703037-101703059 ATGCTGTTATTAGTAGGCAATGG + Intergenic
1073713326 10:106071461-106071483 GTGATGCTATTTGGGGGAAGGGG - Intergenic
1074507280 10:114082636-114082658 ATGATGCAATTAGAGGGAAAAGG + Intergenic
1080998338 11:37633967-37633989 AGGCTGATACTTATGGGAAATGG - Intergenic
1081507296 11:43731855-43731877 ATGCTGCCATTTTTTGGACACGG - Intronic
1082846078 11:57726651-57726673 ATACTGGTATTTGGGAGAAAAGG - Intronic
1083107133 11:60369076-60369098 TTGCTGGAATTTGTGGGAATGGG + Intronic
1086747897 11:90453257-90453279 ATGCTGCTTTTTATGTAAAAGGG + Intergenic
1088598919 11:111458788-111458810 TTGTTGTTATTTGTGGGAAGAGG - Intergenic
1089299186 11:117488213-117488235 AAGCTCCTATTTGTGGGCACAGG - Intronic
1093301483 12:17463890-17463912 ATGCTGATATTTATGGGAGTGGG + Intergenic
1093429172 12:19064485-19064507 ATACTGCTACTTGCGGCAAATGG + Intergenic
1095185664 12:39198027-39198049 ATTGTGCTATATGTGGGAATAGG - Intergenic
1095585708 12:43847137-43847159 CTGCTGATATTTGTGGGAGAAGG + Intronic
1096553283 12:52388332-52388354 ATACAGCTATTTGAGGAAAAAGG - Intergenic
1097156164 12:57013727-57013749 AGGCTGTTTCTTGTGGGAAAAGG - Intronic
1097583923 12:61492558-61492580 ATGCTGCCTTTTGTGGTAAAAGG + Intergenic
1097792743 12:63832135-63832157 AAGCAGCAATTTCTGGGAAAGGG + Intergenic
1097900146 12:64864691-64864713 ACTCTGCCAATTGTGGGAAAGGG - Exonic
1098553315 12:71789553-71789575 ATGCTGATATTTTCTGGAAAAGG + Exonic
1099465963 12:82988448-82988470 TTGCTGGCATTTGTGGGCAAAGG - Intronic
1099681512 12:85835850-85835872 ATGTTGCTAGTTGTGGAAACAGG + Intronic
1101504552 12:105333948-105333970 ATCCTGCTATCTCAGGGAAAGGG - Intronic
1105318319 13:19289544-19289566 ATGATGCTATTTGTATGAAATGG + Intergenic
1105896735 13:24722911-24722933 AAGCTGCTGTTTATGAGAAATGG - Intergenic
1105929427 13:25038495-25038517 ATGCTTGTATATGTGTGAAATGG + Intergenic
1106205398 13:27588614-27588636 ATGCTACTATTGGGGGGAACTGG + Intronic
1108016558 13:46082804-46082826 ATGTTGGTAATGGTGGGAAACGG - Intronic
1108591047 13:51913200-51913222 ACCCTGCCATTTGGGGGAAAGGG - Intergenic
1111616820 13:90670521-90670543 ATTCTGCTATTTCTATGAAATGG - Intergenic
1115321853 14:32089283-32089305 AAGCAGGTATTTGTGGGAGAGGG + Intronic
1117283149 14:54260164-54260186 TTTCTGATATTTGTGTGAAAGGG - Intergenic
1118624029 14:67640649-67640671 GTCCTGGTATTGGTGGGAAAGGG - Intronic
1118703987 14:68462809-68462831 ATTTGGCTATTTGTGGGAGATGG + Intronic
1118787597 14:69059091-69059113 ACGCTTTTATTTTTGGGAAAGGG + Intronic
1120081391 14:80220642-80220664 ATGCTGCTTGTTGGGGGGAATGG + Intronic
1120713153 14:87814119-87814141 AAGCTGCTTTTTCTGGGGAATGG - Intergenic
1123970044 15:25499534-25499556 AAGCTTCTATTTGTGGCAGAAGG - Intergenic
1123976488 15:25558842-25558864 ATACTGATATTTGGGGGAGAGGG + Intergenic
1125044623 15:35231364-35231386 ATGCTGCTGCTTCCGGGAAATGG + Intronic
1127814177 15:62592032-62592054 AAGCCGTTATCTGTGGGAAATGG + Intronic
1128036743 15:64533789-64533811 ATGCTGCTATTGGAGGAAATTGG - Intronic
1128584304 15:68834508-68834530 AGGCTGCTCCTTGTGGGGAAGGG + Intronic
1128856009 15:71016018-71016040 ATGCTGCAATTTGTGAGAAATGG + Intronic
1132070175 15:98769652-98769674 TTGCTGGCATTTGTGAGAAAGGG + Intronic
1132159513 15:99525668-99525690 ATGCTGCCATTTGGAGGAACAGG - Intergenic
1132571427 16:646067-646089 CTGCTGCTCTCTGGGGGAAAGGG - Intronic
1133139538 16:3734180-3734202 ATGCTGTCAATTCTGGGAAATGG - Intronic
1133362208 16:5183395-5183417 AGGCTGCTCTTTGTTAGAAAAGG + Intergenic
1133815672 16:9195520-9195542 AGGTTGCTCTTTCTGGGAAAGGG + Intergenic
1137512109 16:49110129-49110151 ATGTTGCTATTGAAGGGAAAAGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139661185 16:68421876-68421898 ATGCTACTCTATGTGGCAAAAGG + Intronic
1141114960 16:81300528-81300550 ATGTTGCTTTATGTGGCAAAAGG - Intergenic
1144571790 17:16404762-16404784 TTGCTGCTGCTTGGGGGAAAAGG - Intergenic
1146941037 17:36844750-36844772 ATGCTGCTATTTTGTGCAAATGG + Intergenic
1147548048 17:41418502-41418524 TTGCTGGAATTTGTGAGAAATGG + Intergenic
1149666572 17:58369007-58369029 TTGCTGCTATTGGTGGGAGCTGG - Intronic
1149783901 17:59419756-59419778 ATGCTGTTTTTTTTGGGAACAGG + Intergenic
1150856715 17:68760136-68760158 GTGCTGCTTTTTGTTGCAAAAGG - Intergenic
1150997765 17:70338855-70338877 ATGCTGCTATTTGTGGCCAGAGG - Intergenic
1151021425 17:70621743-70621765 ATGCTGCCACTTCTGGGGAAAGG + Intergenic
1153784962 18:8526248-8526270 ATGCTCCTAGCTGTGGGAGAGGG - Intergenic
1155000479 18:21681299-21681321 ATGCTGCTATTTGCTGAAATAGG - Intronic
1155513420 18:26600101-26600123 AGGCTGCTTCTTGTGGGGAAGGG + Intronic
1155748748 18:29393526-29393548 ATGTGGCTATCTGAGGGAAAGGG + Intergenic
1155768483 18:29668351-29668373 ATGCTCTGATTTGTGGCAAATGG - Intergenic
1156159103 18:34338297-34338319 ATGTCACTATTTGTGGGAAGAGG + Intergenic
1158726335 18:59976233-59976255 ATGTTGCTACATGTGGAAAATGG - Intergenic
1159194686 18:65097564-65097586 ATCCTGCTATTTATGCGTAATGG - Intergenic
1160725233 19:614885-614907 ATGCTGCTGTTCGTGGGAATGGG + Intronic
1165285061 19:34834764-34834786 ATGCTGAAATTTCTAGGAAAAGG - Intergenic
1166255950 19:41604731-41604753 AGGCTGCTCTTTGTTAGAAAAGG + Intronic
925813983 2:7729070-7729092 ATGCTTCTGTTTCTGGGAAAAGG + Intergenic
926387816 2:12354705-12354727 ATGCTCCTATCTGTGGGGAAAGG - Intergenic
927118176 2:19925336-19925358 ATTCTGCCATATGTGGGAATGGG + Intronic
928277605 2:29917237-29917259 ATGGGGCTATTTGTGGGGGAGGG - Intronic
928335756 2:30396616-30396638 CTGCTGCTATTCTGGGGAAAGGG - Intergenic
935351332 2:102154055-102154077 GTTCAGCTATTTGTGAGAAAAGG - Intronic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
939634218 2:144561229-144561251 ATGTTGCTATATGTAGTAAATGG + Intergenic
940198593 2:151124695-151124717 ATGCTGCTATTTATTGTACATGG - Intergenic
940318721 2:152351348-152351370 CTGCTGGGATTGGTGGGAAAGGG - Intronic
940501568 2:154500721-154500743 AGGCTGCTATTGGAGGTAAAGGG - Intergenic
940989259 2:160081462-160081484 AGGCTGCTCTTTGTTAGAAAAGG + Intergenic
941634739 2:167924522-167924544 CTGCTACTATTTGTGTAAAAAGG + Intergenic
941733644 2:168948011-168948033 ATCCTGCATTTTGTAGGAAATGG + Intronic
943338521 2:186648118-186648140 ATGCAGCTATTTGTTACAAAGGG - Intronic
943836355 2:192518615-192518637 ATTCTGGGATTTGGGGGAAAGGG - Intergenic
946465881 2:219911718-219911740 ATGCTGGCCTTTGAGGGAAAAGG + Intergenic
946859285 2:223985060-223985082 AGGAAGCTATTTGTGGAAAAGGG - Intronic
947582059 2:231326441-231326463 ATGGTGCTGATTGTTGGAAAAGG + Intronic
948655799 2:239476043-239476065 TTCCTGGTATATGTGGGAAATGG + Intergenic
1177557849 21:22715083-22715105 ATGCAGAAATTTCTGGGAAAAGG - Intergenic
1179195885 21:39162089-39162111 AGGCTTCTATTTGTGGTTAATGG + Intergenic
1179217113 21:39377106-39377128 ATGTTACTTTTTGTGGCAAATGG + Intergenic
1179962208 21:44774268-44774290 ATGATGATATTTGGTGGAAAGGG - Intronic
1180139969 21:45887298-45887320 AGGCTGCTGCTTCTGGGAAATGG - Intronic
1180949819 22:19715914-19715936 AGGCTACTGTTTGAGGGAAATGG + Intronic
1181677633 22:24466992-24467014 ATGGTGCTACGTGTAGGAAATGG - Intergenic
1183161444 22:36116104-36116126 ATGCTGATACTTTTGGGGAAAGG + Intergenic
1183201035 22:36386338-36386360 AGGCTGCTATGTGTGGGGGAAGG - Intronic
1184910149 22:47526552-47526574 ATTCTGCTGTTTATAGGAAAAGG + Intergenic
949729537 3:7092680-7092702 CTGCTGCTATTTTTGAGAAGGGG + Intronic
950809882 3:15641171-15641193 ATGTTGCCAGGTGTGGGAAAAGG + Intronic
950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG + Intronic
952912844 3:38205137-38205159 CTGCAGCTACTTCTGGGAAATGG + Intronic
953222854 3:40989250-40989272 AAGCAGATATTTGTGGGAAGAGG + Intergenic
953852360 3:46474623-46474645 ATTCTGCTATTGTTGGGTAAAGG - Intronic
954648722 3:52146768-52146790 CTCCTGCTATTTGTGGGATGGGG + Intronic
956189728 3:66597092-66597114 ATGCTGCTCTTTATTAGAAAAGG - Intergenic
957168595 3:76708403-76708425 TAGCTGTTATTTCTGGGAAATGG + Intronic
958724736 3:97890783-97890805 TTGGTCCTATTTGTGGGTAATGG - Intronic
960613244 3:119573862-119573884 ATGCTGCCATTTTTTGTAAAAGG - Intergenic
961021183 3:123508430-123508452 ATGATGCTATTTGTGTGTAAAGG - Intronic
961241888 3:125418350-125418372 ATGCTGCTGTCTCTGAGAAAGGG + Intergenic
962791499 3:138815631-138815653 ATGCTGCCATTTGTGAGAGTGGG + Intronic
963015141 3:140816907-140816929 ATGCAGAAATTTCTGGGAAAAGG + Intergenic
963286383 3:143438317-143438339 ATGCTGCTCTTTGAGGGGAGTGG - Intronic
964816948 3:160727762-160727784 ATGTGGATATTTGAGGGAAAGGG + Intergenic
964822330 3:160785596-160785618 ATGCTTCTATTTATATGAAAAGG - Intronic
966903668 3:184506349-184506371 TTGCTGCTATTGGAGGGCAAAGG + Intronic
967449039 3:189601735-189601757 ATGCTACTGAATGTGGGAAATGG - Intergenic
967473457 3:189889456-189889478 ATGCTGCAATCTGTGGGATACGG - Exonic
967730959 3:192906328-192906350 GAGCTGCTTTTTGTGGGTAAAGG - Intronic
970745099 4:19284633-19284655 ATGCTGCCTTATTTGGGAAAGGG + Intergenic
975468157 4:74733276-74733298 ATGCTCCTCTGTGTTGGAAAAGG - Intergenic
978343136 4:107738497-107738519 ATGCTGCTCTGAGTGGGCAATGG + Intergenic
980312821 4:131156039-131156061 ATTCTGCTTATTGTTGGAAATGG - Intergenic
983235099 4:165170458-165170480 AAGCTGCTCTTTGTAGAAAAGGG - Intronic
983927847 4:173420988-173421010 CTGCTGTTTTTTGTGGTAAAAGG - Intergenic
984704157 4:182835537-182835559 ATGCAGACATTTGTGGGAGAGGG - Intergenic
984928040 4:184824098-184824120 ATGCTTATAATTGTGGGGAAGGG + Intronic
985226540 4:187767391-187767413 AGGCTTCCATTGGTGGGAAACGG + Intergenic
986258967 5:6126050-6126072 TTGGTGCTATTTGTGGGGCATGG + Intergenic
989306918 5:39968656-39968678 CTGCTGCAATAAGTGGGAAATGG - Intergenic
989396564 5:40963462-40963484 ATGCTGAGGTTTGAGGGAAATGG - Intronic
989475046 5:41865233-41865255 ATGCTTTTATTTGTGGGCAGGGG - Intronic
991040382 5:62169139-62169161 ATTCTGCTGTTTGTGGGAGTGGG - Intergenic
991584863 5:68191495-68191517 AAGCTACTATTCTTGGGAAATGG + Intronic
992802775 5:80308896-80308918 AGGCTGCTCTTTGTTAGAAAGGG + Intergenic
993057366 5:82997634-82997656 ATGCTGTTTTTAGTGAGAAAGGG + Intergenic
993278989 5:85900340-85900362 ATGCTGCTTTTTGGAGCAAATGG - Intergenic
1000723278 5:164735168-164735190 ATGCCTCTATGTGTGGGAAAGGG - Intergenic
1000735749 5:164897936-164897958 ATGCTGCAATTTTTGGAAAGAGG + Intergenic
1002099733 5:176851474-176851496 ATGCCGCCATATGTGGGACAGGG + Intronic
1004221984 6:13754986-13755008 ATGCTGCTATTTGTGTGTTGGGG + Intergenic
1004399156 6:15272561-15272583 CAGCTGCAATTTGGGGGAAATGG - Intronic
1004547156 6:16608963-16608985 ATCTTTATATTTGTGGGAAATGG - Intronic
1004923463 6:20398272-20398294 ATTGTGATATTTGTGGGGAAAGG - Intergenic
1005762420 6:28979725-28979747 AGGCTGCTCTTTGTTAGAAAAGG - Intergenic
1006113694 6:31763868-31763890 ATTGTGCTATTTGAGGGAGATGG + Intronic
1007263154 6:40577858-40577880 CTGCTCCTAGTGGTGGGAAAGGG - Intronic
1008056407 6:46950337-46950359 AGGTTGCTCTGTGTGGGAAAAGG - Intronic
1008694721 6:54021968-54021990 AAGCTAATTTTTGTGGGAAATGG + Intronic
1008702013 6:54112182-54112204 TTGCTGCTTTGTGTGGAAAATGG + Intronic
1008957576 6:57232716-57232738 AGTCTGCTATTTGTAAGAAAGGG - Intergenic
1009318997 6:62261574-62261596 ATGCTGCCACTAATGGGAAATGG - Intronic
1010951378 6:82040821-82040843 ATGCTGCTGATTGTAGGAATGGG + Intergenic
1011265907 6:85519027-85519049 ATGCTGTTACTTGTTGGAATAGG - Intronic
1013575033 6:111474440-111474462 CAGCTGCCTTTTGTGGGAAAGGG - Intronic
1014721795 6:124925986-124926008 ATGCTGCTATTAGTCAGATAAGG - Intergenic
1014830121 6:126092995-126093017 GTGCTGGAATTTGTGGGAAAAGG + Intergenic
1015889151 6:137952038-137952060 ATGAAGCTATTTGGGGGATAAGG + Intergenic
1018512883 6:164545035-164545057 ATGGTACTATGTTTGGGAAAGGG - Intergenic
1019775785 7:2911392-2911414 ATGGTCCTATTGGTGGGGAATGG - Intronic
1019804842 7:3116111-3116133 AAGGTCCTATTTGTGGGGAAAGG - Intergenic
1021000898 7:15328956-15328978 ATACTGCTATTTTAGGGAATAGG - Intronic
1021036545 7:15807133-15807155 ATACTACTTTTTGTGGCAAAGGG + Intergenic
1021633608 7:22669549-22669571 ATGCTGGTATTTGTTGGAGGAGG + Intergenic
1022147133 7:27555630-27555652 ATGCTGCCATAAGTGGGTAATGG - Intronic
1022210221 7:28201316-28201338 ATCTTGCTATTTAGGGGAAAAGG - Intergenic
1023202181 7:37710661-37710683 ATGGTACTTTTAGTGGGAAATGG + Intronic
1024326080 7:48110132-48110154 AGGCTGCTATTAGTAAGAAAAGG + Intergenic
1026222376 7:68411743-68411765 AGGCTGCTCTTTGTTAGAAAAGG - Intergenic
1026335461 7:69390675-69390697 GAGGTGCTATTTATGGGAAATGG - Intergenic
1026463017 7:70631402-70631424 ATGCTGCTCTGTGCGGGAAGAGG + Intronic
1026624844 7:71982778-71982800 AGGCTGCTGTTTGTTAGAAAAGG - Intronic
1027406465 7:77866956-77866978 ATGCTGCAATATGAAGGAAAAGG + Intronic
1028307855 7:89289491-89289513 CTGCTGCTAGGGGTGGGAAAGGG - Intronic
1028462992 7:91117161-91117183 ATGCTGCTATTTATTGACAACGG - Intronic
1028875532 7:95818970-95818992 ATGCTGCTAATTGTGAGCACAGG - Intronic
1030427812 7:109401931-109401953 ATGCTGCTGTTTGTATAAAATGG - Intergenic
1031519566 7:122747064-122747086 AGGCTGCTATTTGTGATAATTGG - Intronic
1034392436 7:150797238-150797260 ATGCTGCTATTTGTGGGAAAAGG - Intronic
1035932345 8:3793950-3793972 ATGCTGCTATGTGTAATAAATGG + Intronic
1037039105 8:14208926-14208948 AGGCTGCTTTTTGTTAGAAATGG - Intronic
1039558438 8:38494061-38494083 ATGCTACTATTTGTCGAAAAAGG - Intergenic
1040749098 8:50683552-50683574 TTGCAGATCTTTGTGGGAAATGG - Intronic
1041939045 8:63366629-63366651 AGGCTGCTCTTTGTTAGAAAAGG + Intergenic
1042508115 8:69582855-69582877 ATACTGCATTTTGTTGGAAAAGG + Intronic
1043790384 8:84459608-84459630 ATGTTTCTAACTGTGGGAAATGG + Intronic
1047640582 8:126817120-126817142 AAGGTGCTACTTGAGGGAAATGG + Intergenic
1048425071 8:134315895-134315917 ATGCAGTAATTGGTGGGAAATGG + Intergenic
1048865920 8:138761480-138761502 ATCCAGATATTTGTGGGAGATGG + Intronic
1051078996 9:13275033-13275055 AAGCTGCTATTTGAGGACAAAGG - Intronic
1051795396 9:20863284-20863306 CTGCTGCTCTTTGAAGGAAAAGG - Intronic
1058845613 9:108955523-108955545 ATGATGCTATTACTGGGATATGG + Intronic
1059197180 9:112381120-112381142 CTGCTGCTATTTTTAAGAAAGGG - Intronic
1059258916 9:112957089-112957111 AATCTGCTGTTGGTGGGAAAGGG + Intergenic
1059501335 9:114756683-114756705 GTGGTGCTGGTTGTGGGAAAGGG + Intergenic
1059778184 9:117497969-117497991 TCCCTGCTATTTGTAGGAAAGGG + Intergenic
1061211949 9:129198798-129198820 GTGCTGTTATTTGGGGGAGAGGG + Intergenic
1185631096 X:1516296-1516318 GTGCTTATATTTGTGGGAGAGGG - Intronic
1186308334 X:8289632-8289654 ATGCTGCTATCTGTGGGAGCAGG - Intergenic
1188524486 X:31074380-31074402 ATGTAGTTTTTTGTGGGAAAGGG + Intergenic
1188879216 X:35471387-35471409 ATGCTGGTATTTAGGGGAGATGG + Intergenic
1188918616 X:35944102-35944124 ATGCTGCTGATTAGGGGAAAAGG - Intronic
1190512560 X:51188625-51188647 ATCCTGTCATTTGTGGCAAATGG + Intergenic
1191640392 X:63425129-63425151 TTGTTGCTCTTTGTGGGAACAGG + Intergenic
1191873616 X:65771847-65771869 ATGCTAATATTTGTGGAAAGAGG - Intergenic
1193944998 X:87724095-87724117 GTGGTGCTGTTTGGGGGAAATGG + Intergenic
1194491136 X:94551409-94551431 ATTCTCCTTTTTGTGGGAATGGG - Intergenic
1195353719 X:104018643-104018665 ATGATGATATTTGAGAGAAATGG - Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1198210838 X:134514388-134514410 ATGCTACTATTTGTGTTACAAGG - Intronic
1198253520 X:134905048-134905070 ATGCTGCCATTTGTATAAAAAGG + Intronic
1200308057 X:155048405-155048427 ATGCTGCAAATGTTGGGAAAGGG - Intronic