ID: 1034398748

View in Genome Browser
Species Human (GRCh38)
Location 7:150847556-150847578
Sequence CTATATACAAAGGTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034398748_1034398757 15 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1034398748_1034398752 -1 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398752 7:150847578-150847600 GCGCTGCCCCTCCTTAGGCCTGG No data
1034398748_1034398751 -6 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398751 7:150847573-150847595 ATATAGCGCTGCCCCTCCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034398748 Original CRISPR CTATATACAAAGGTGGAGCT AGG (reversed) Intronic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
903029866 1:20456174-20456196 CTATTTAGAAATGTGGAGCTGGG - Intergenic
907544328 1:55246451-55246473 CTATTTACAGAGGTGAAGCCAGG + Intergenic
910488421 1:87741677-87741699 CTCTATGTAAAGCTGGAGCTTGG - Intergenic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG + Intronic
1066214727 10:33275055-33275077 AAATATACAATGGTGGAGCTAGG + Intronic
1068848379 10:61706952-61706974 CTTTATACAAAGGTGCAGGCTGG - Intronic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG + Intronic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083251684 11:61472118-61472140 CCATACACAAAGGTGGAGTAGGG + Intronic
1085849180 11:80099737-80099759 TTATTTACAAAAGTGGTGCTTGG + Intergenic
1085894110 11:80616778-80616800 GAATATAAAATGGTGGAGCTAGG - Intergenic
1086767613 11:90717737-90717759 CTAGAAACAAAGGTGGAGGTGGG - Intergenic
1087528184 11:99345389-99345411 CTGTGTACAAAGGTGAAGATAGG - Intronic
1088535997 11:110862126-110862148 CTATTTACAAAGGTGTGGCCAGG + Intergenic
1090556704 11:127884035-127884057 CTATATGCAAAGCTGAAGCCTGG - Intergenic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1093529879 12:20148063-20148085 CTATATAAAAAGAGGGAGCCAGG - Intergenic
1093943684 12:25083710-25083732 CAATAAATTAAGGTGGAGCTAGG - Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1095721519 12:45406322-45406344 CAAAACACTAAGGTGGAGCTGGG - Intronic
1099003225 12:77205846-77205868 CAATATACAACAGTGGAACTGGG - Intergenic
1102003758 12:109575357-109575379 CTATATACCTTGGTAGAGCTTGG + Intronic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1109075483 13:57829317-57829339 CTTTATAGAAAGGTGAAGTTTGG - Intergenic
1110425451 13:75361930-75361952 CGTTATATAGAGGTGGAGCTGGG + Intronic
1112121010 13:96411418-96411440 ATATTTACAAAGGTTGAGATGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115480334 14:33854797-33854819 TTATATCCAAAGGTTGAGATGGG - Intergenic
1116370455 14:44123905-44123927 CTATATACAAAGGAGAATCTAGG - Intergenic
1124337524 15:28868473-28868495 CTATTTACAAAGGCGGGGCAGGG + Intergenic
1129437894 15:75556990-75557012 CTATATACCATGATGGACCTTGG - Intronic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG + Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1139361362 16:66402171-66402193 CTATATACATAAGTAAAGCTGGG - Intronic
1140699544 16:77568580-77568602 GTATATACAAATGTGAACCTTGG - Intergenic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1150351280 17:64446800-64446822 CTATATGAAAATGTGGAGCCGGG + Intergenic
1151060246 17:71084126-71084148 CTAGATACCAAGGTGGAGAAGGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159982172 18:74796448-74796470 CTATATAGAAAAATGCAGCTTGG - Intronic
1165302812 19:34982318-34982340 CTATTTATAAACGTGGAGCCGGG - Intergenic
1166144367 19:40824061-40824083 TTATACCCAGAGGTGGAGCTTGG + Intronic
926363220 2:12109798-12109820 CCTTATACAAAGGTGGAATTTGG - Intergenic
926580234 2:14626738-14626760 TTATATACGAAGGTGGAGAGAGG + Intergenic
929693084 2:44090738-44090760 CTATTTACAAAGGTGCAGGCAGG - Intergenic
933406767 2:81870265-81870287 GTAAATACATAGGTGGGGCTTGG - Intergenic
936140126 2:109932233-109932255 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936176815 2:110230178-110230200 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936204570 2:110439253-110439275 CTACTTACAAAGGTGGGGGTGGG + Intronic
936884552 2:117294528-117294550 CTTTCTATAAAGGTGGATCTAGG - Intergenic
937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG + Intronic
939872803 2:147543536-147543558 CTTTATACAAAGGATGAGTTTGG + Intergenic
942995485 2:182255178-182255200 CTATAAACACAGGTTGATCTAGG - Intronic
943426674 2:187746434-187746456 CTGTATACAAAGGTGTGGATAGG + Intergenic
944862079 2:203824695-203824717 GGATATACAGACGTGGAGCTAGG + Intergenic
1169414248 20:5402479-5402501 CAATCTCCAAAGGTGGAGCTGGG - Intergenic
1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG + Intronic
1179332700 21:40420699-40420721 CTTTATACAAAGGGGGAATTTGG + Intronic
1181683812 22:24514805-24514827 TTATATAGAACGGTGGAGCCCGG - Intronic
1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG + Intergenic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
951356825 3:21677358-21677380 AAATATACAAATCTGGAGCTTGG + Intronic
955451295 3:59069824-59069846 TAATATACAAAGGTGGAACAGGG + Intergenic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
955665870 3:61348678-61348700 CTAGTTACAAAGGTGTAGATTGG + Intergenic
957733862 3:84180652-84180674 CAATATACAAAGGCAGAGCAAGG - Intergenic
959760351 3:109955760-109955782 CTATAAACAAATGTGGAGAAAGG - Intergenic
960223020 3:115138273-115138295 CTATTTGCAACAGTGGAGCTGGG - Intronic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
963777177 3:149451427-149451449 CAAGATACAATGGGGGAGCTTGG + Intergenic
970682719 4:18529228-18529250 GTATATACAAGGTTGGAGCAAGG - Intergenic
971040101 4:22742377-22742399 TCATATACAAAGGTGGCACTGGG - Intergenic
972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG + Intergenic
977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG + Intronic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978106767 4:104912024-104912046 GTATATACAGTGGTGGAGCAGGG + Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
987685344 5:21192018-21192040 CAATATATAAAGGTGCAGTTTGG - Intergenic
988507107 5:31833170-31833192 CTAGAAACAAAGGTGGAGGCTGG + Intronic
990037392 5:51338340-51338362 TTATATACAAATGTAGAGGTAGG - Intergenic
993314138 5:86377456-86377478 CTATATAATTAGGTGGAACTAGG + Intergenic
993462888 5:88207330-88207352 CCATATACTAAGTTGTAGCTAGG + Intronic
996370930 5:122751775-122751797 CTATTTACAGAGGTGTAGGTAGG - Intergenic
996450974 5:123624542-123624564 CTATTTAGAAAGGTGCAGCAGGG - Intergenic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
1000602211 5:163288391-163288413 CTATAGAAAAAGGTGGCTCTTGG - Intergenic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG + Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG + Intronic
1007831414 6:44641624-44641646 CAATAGACAAAGCTGGAGTTTGG - Intergenic
1010410373 6:75554691-75554713 ATATTTACAAAGGTGTGGCTGGG - Intergenic
1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG + Intergenic
1011900713 6:92292370-92292392 CTATTTACAAAGGTGGGATTGGG - Intergenic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018337150 6:162805172-162805194 CTATATATAAAGGGCGACCTTGG + Intronic
1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG + Intergenic
1022547331 7:31201265-31201287 CCATTTACAAAGGTAGAGCAGGG + Intergenic
1031859442 7:126961169-126961191 CTATGTAAAAAGGTTAAGCTTGG + Intronic
1031974925 7:128087546-128087568 CTAGAGACAAAGGTGGTGCTGGG + Intronic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG + Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1037061552 8:14516977-14516999 ATAGATACAAGGGTGGAGCCAGG + Intronic
1037165567 8:15824384-15824406 ATATATACAAACTTGGTGCTAGG + Intergenic
1039819352 8:41122441-41122463 CTCTATCCAAAGGTGGAACAAGG - Intergenic
1040662936 8:49596578-49596600 CCTTATACAAAGGAGGAGCCTGG + Intergenic
1041947534 8:63462911-63462933 CTATAAACAAAGGCTTAGCTTGG + Intergenic
1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG + Intronic
1045386634 8:101677432-101677454 CTATATACAATCTTGGAGGTAGG - Intergenic
1049851359 8:144832815-144832837 CCCAATACAAATGTGGAGCTGGG - Intronic
1050014466 9:1219405-1219427 CTATTTACAAAGGGGCAGTTAGG + Intergenic
1056444965 9:86656679-86656701 CTCCATACAAAAGTGGAGTTTGG - Intergenic
1061094659 9:128448690-128448712 CTATATCCAAATGAGCAGCTGGG - Intergenic
1185643077 X:1599049-1599071 CTTTATCCCAAGGTGGACCTCGG - Intronic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1198609218 X:138379070-138379092 CTATTTACAAAAGTGTGGCTAGG - Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic