ID: 1034398751

View in Genome Browser
Species Human (GRCh38)
Location 7:150847573-150847595
Sequence ATATAGCGCTGCCCCTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034398745_1034398751 27 Left 1034398745 7:150847523-150847545 CCACAGGACATGGTGAGCTGTGA 0: 1
1: 0
2: 4
3: 53
4: 325
Right 1034398751 7:150847573-150847595 ATATAGCGCTGCCCCTCCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1034398748_1034398751 -6 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398751 7:150847573-150847595 ATATAGCGCTGCCCCTCCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1034398747_1034398751 4 Left 1034398747 7:150847546-150847568 CCTCTGGCTTCCTAGCTCCACCT 0: 1
1: 0
2: 2
3: 45
4: 430
Right 1034398751 7:150847573-150847595 ATATAGCGCTGCCCCTCCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034398751 Original CRISPR ATATAGCGCTGCCCCTCCTT AGG Intronic
909615553 1:77604958-77604980 ATCTTGCTCTGCCCCTCTTTAGG - Intronic
912565200 1:110582497-110582519 ATCTAGCCCAGCCCCTCCTTTGG - Intergenic
913558181 1:119990898-119990920 ATATAGCCTTTCCCCTACTTTGG - Intronic
913639661 1:120799554-120799576 ATATAGCCTTTCCCCTACTTTGG + Intergenic
914278787 1:146150389-146150411 ATATAGCCTTTCCCCTACTTTGG - Intronic
914539834 1:148601331-148601353 ATATAGCCTTTCCCCTACTTTGG - Intronic
914626812 1:149469889-149469911 ATATAGCCTTTCCCCTACTTTGG + Intergenic
917017881 1:170555071-170555093 TTATAGAGCTGTCCCTCCTTGGG + Intergenic
922390603 1:225137891-225137913 AGATAGCGCTGCCCCTCACCCGG + Intronic
923962314 1:239099813-239099835 ATATACAGCTACCCCACCTTAGG + Intergenic
924782880 1:247169187-247169209 AGTTAGCGCTGCTCCTCCCTGGG - Intronic
1063609896 10:7553392-7553414 ATCCAGCACTGCCCATCCTTGGG - Intergenic
1064253553 10:13725419-13725441 ATTTAGACCTGCCCCTCTTTAGG + Intronic
1068849499 10:61720792-61720814 ATATAGCGGTGAACCTCCATGGG + Intronic
1077433068 11:2525654-2525676 ATGCAGCCCTACCCCTCCTTGGG - Intronic
1085399446 11:76226968-76226990 ATAAGGCACTGCCCCTCCCTGGG - Intergenic
1086200500 11:84195491-84195513 ATATTTCTCTGCCTCTCCTTTGG + Intronic
1086613416 11:88784806-88784828 ATACAGGGCTGCCCGTCTTTGGG + Intronic
1090856213 11:130611120-130611142 AGATAGCTCTGCCCCACCTTTGG + Intergenic
1091038414 11:132254542-132254564 ATCTACCGCTGGCCTTCCTTTGG + Intronic
1094178400 12:27565268-27565290 AATGAGTGCTGCCCCTCCTTGGG - Intronic
1117406847 14:55412004-55412026 ATATAACTCTCCCCCTGCTTCGG - Intergenic
1121658445 14:95616097-95616119 ATTTGGGGCTGCCCTTCCTTAGG - Intergenic
1124558275 15:30747627-30747649 ACATGGCACTGCCCCTCCTAAGG + Intronic
1144454448 17:15407403-15407425 AAACAGCTCAGCCCCTCCTTTGG - Intergenic
1147315793 17:39619445-39619467 CTAGAGCACTGACCCTCCTTAGG - Intergenic
1148143740 17:45346551-45346573 AGAGAGGGCTGCCCCTCCTTTGG + Intergenic
1155147564 18:23096817-23096839 ACATAGAACTGCCCCCCCTTTGG + Intergenic
1157143487 18:45136680-45136702 ATCTACCTCTGCCCCTCTTTTGG - Intergenic
1161772583 19:6239119-6239141 ACAGAGCCCTGCCCCTCCTCTGG + Intronic
1168327968 19:55547577-55547599 TTCTACCTCTGCCCCTCCTTGGG - Intergenic
928132416 2:28662190-28662212 AAACAGCCCTGCCCCTCCTGTGG + Intergenic
932221156 2:69999970-69999992 CTCTAGCCCTGCCCCACCTTCGG + Intergenic
937560428 2:123218068-123218090 ATCTTGCTTTGCCCCTCCTTTGG - Intergenic
948407544 2:237733785-237733807 GTACAGCGCTGCCCGGCCTTCGG + Intronic
948739004 2:240030796-240030818 ACACAGAGCTGGCCCTCCTTAGG + Intergenic
1172617284 20:36297784-36297806 ACAGAGTGCTGTCCCTCCTTTGG - Intergenic
1175637298 20:60596510-60596532 AAAAAGGGCTGACCCTCCTTGGG + Intergenic
1181135317 22:20761739-20761761 ATAGAGAGCTGCCTCTCGTTTGG - Intronic
949919467 3:8989854-8989876 ATTTAGCTCTGCCCACCCTTTGG + Intronic
957266718 3:77976236-77976258 ATATAGCTCTGCCTTTCCTCTGG + Intergenic
972333582 4:38085572-38085594 AGGTAGAGCAGCCCCTCCTTCGG + Intronic
980407386 4:132370706-132370728 CTATAGATCTGCCACTCCTTTGG + Intergenic
983977104 4:173948711-173948733 ATACATTGCTGCCCATCCTTGGG - Intergenic
1003045593 6:2730198-2730220 TGACAGCGCTTCCCCTCCTTGGG - Intronic
1022832312 7:34080076-34080098 ATATTGCACTGCCTTTCCTTTGG + Intronic
1023899796 7:44466945-44466967 AGAGAGCACTGGCCCTCCTTGGG + Intronic
1032512784 7:132485267-132485289 ATACAGCGCTCCACCCCCTTAGG + Intronic
1034398751 7:150847573-150847595 ATATAGCGCTGCCCCTCCTTAGG + Intronic
1186621202 X:11241872-11241894 CAATAGCGATGCCTCTCCTTAGG + Intronic
1202038759 Y:20661442-20661464 AACTAGCCCTGCCCCACCTTGGG + Intergenic