ID: 1034398752

View in Genome Browser
Species Human (GRCh38)
Location 7:150847578-150847600
Sequence GCGCTGCCCCTCCTTAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034398749_1034398752 -8 Left 1034398749 7:150847563-150847585 CCACCTTTGTATATAGCGCTGCC 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1034398752 7:150847578-150847600 GCGCTGCCCCTCCTTAGGCCTGG No data
1034398748_1034398752 -1 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398752 7:150847578-150847600 GCGCTGCCCCTCCTTAGGCCTGG No data
1034398747_1034398752 9 Left 1034398747 7:150847546-150847568 CCTCTGGCTTCCTAGCTCCACCT 0: 1
1: 0
2: 2
3: 45
4: 430
Right 1034398752 7:150847578-150847600 GCGCTGCCCCTCCTTAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034398752 Original CRISPR GCGCTGCCCCTCCTTAGGCC TGG Intronic
No off target data available for this crispr