ID: 1034398757

View in Genome Browser
Species Human (GRCh38)
Location 7:150847594-150847616
Sequence GGCCTGGACCTCCTTAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034398749_1034398757 8 Left 1034398749 7:150847563-150847585 CCACCTTTGTATATAGCGCTGCC 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1034398748_1034398757 15 Left 1034398748 7:150847556-150847578 CCTAGCTCCACCTTTGTATATAG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1034398747_1034398757 25 Left 1034398747 7:150847546-150847568 CCTCTGGCTTCCTAGCTCCACCT 0: 1
1: 0
2: 2
3: 45
4: 430
Right 1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1034398750_1034398757 5 Left 1034398750 7:150847566-150847588 CCTTTGTATATAGCGCTGCCCCT 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034398757 Original CRISPR GGCCTGGACCTCCTTAAGAA AGG Intronic
902142746 1:14370294-14370316 TGCCTGGGCCTCCTGAAGGAAGG - Intergenic
902539945 1:17147267-17147289 GGGCTGAGCCTCCTTAGGAAGGG + Intergenic
903575596 1:24337797-24337819 GGCCTGGAGCAGCTTCAGAAGGG + Intronic
904834907 1:33329468-33329490 GTCTTAAACCTCCTTAAGAATGG - Intronic
905885623 1:41490359-41490381 GGCCTAGACCTCCTTAGAAGGGG - Intergenic
914901432 1:151713245-151713267 GGGCTGGACTTCCTCAAGAAGGG + Intronic
915931811 1:160065410-160065432 GGCCTGTACCTCCGTCAGATTGG - Intronic
921065640 1:211620561-211620583 GGCCTGGGCCACCTCCAGAAAGG + Intergenic
1076876613 10:133219387-133219409 GACCTGGACCTCCTCCAGGACGG + Intronic
1077407410 11:2388807-2388829 GGCCTGGCCCTCCTTGAGAGTGG + Intronic
1080029101 11:27642351-27642373 GGCCTTTACCTTCTTGAGAATGG + Intergenic
1080200346 11:29662141-29662163 GGCCTAGACTTCCTACAGAATGG - Intergenic
1080685550 11:34512117-34512139 CCCTTGGACCTCCCTAAGAAGGG + Intronic
1082028156 11:47587444-47587466 GGCCTGGAGCTCTTTAACAAGGG + Intronic
1085763697 11:79263888-79263910 GGCCTAGACCTCCCTATGCATGG + Intronic
1088941820 11:114467393-114467415 GGACTAGATCTCCTTAAAAACGG - Intergenic
1089096057 11:115921034-115921056 GGCCTTGCCCTCCTGAAGAGAGG + Intergenic
1090199881 11:124846381-124846403 GGCCGGCACCTCATTGAGAAGGG - Intergenic
1091353600 11:134916700-134916722 GGCCTCGACTTCCTCAAGAAAGG - Intergenic
1094643747 12:32301070-32301092 GGCCTTTACCTCCTTATGAAAGG - Intronic
1096183408 12:49563655-49563677 GGCCAGGCCCTCATTAGGAAGGG + Intronic
1096691972 12:53326971-53326993 GGGGTGCACCTCCTGAAGAATGG - Exonic
1096779436 12:53983692-53983714 GGCTTGGGCCTCCTTAGAAACGG + Intergenic
1099175534 12:79417634-79417656 GGCCTGGACCTTGTCATGAAAGG - Intronic
1102245910 12:111355649-111355671 AGGCTGCAGCTCCTTAAGAAAGG - Intergenic
1105838367 13:24230801-24230823 GGTCTGGACATCATTAGGAAGGG + Intronic
1113851938 13:113422904-113422926 GGCCTGGACCTCGTTCCCAAAGG - Exonic
1116447428 14:45026747-45026769 CGCCTGGGCCTCCCAAAGAATGG - Intronic
1118723345 14:68609386-68609408 GGCCTGGACCTGCTCAGTAAGGG - Intronic
1129463534 15:75711665-75711687 GGCCTGAGCCTCCTTCACAAGGG - Intronic
1129721352 15:77879737-77879759 GGCCTGAGCCTCCTTCACAAGGG + Intergenic
1133019632 16:2961665-2961687 ACCCTGCACCGCCTTAAGAAGGG + Intergenic
1133223399 16:4328685-4328707 GGACTGGACCTGCTGATGAAGGG + Intronic
1142891890 17:2949049-2949071 AGCCTGGTCTTCCTTCAGAAAGG - Intronic
1143591642 17:7888664-7888686 GGCCTGTACCTGCTTCAGCAGGG - Intronic
1144647452 17:16985097-16985119 GGCCTGGGCCACCAGAAGAATGG - Intergenic
1152525836 17:80887929-80887951 GGCCTGGCCCTTCTTGACAAGGG - Intronic
1152642666 17:81455700-81455722 GCCCTGGGCCACCTGAAGAAAGG - Intronic
1152771124 17:82170034-82170056 GGCCTGGAGCTCCAAAAGAGGGG + Intronic
1152988763 18:343330-343352 GGCCGGGACCTCCTAAAGCTGGG + Intronic
1153740004 18:8114518-8114540 GCCCCGGACCTCCTTTAGTAAGG - Intronic
1154339399 18:13490788-13490810 AGCCTGGCCCTCCTCCAGAATGG - Intronic
1156259597 18:35432595-35432617 GGCCTGGATTTCCTTCAGCAGGG - Intergenic
1157276684 18:46315547-46315569 TACCTAGACCACCTTAAGAAAGG - Intergenic
1160925514 19:1543099-1543121 TGCCTCGACCTCCTTAAGTGCGG - Intergenic
1161742016 19:6027143-6027165 GTCTTTGGCCTCCTTAAGAAAGG - Intronic
1164794284 19:31013982-31014004 GGCCTTGACCTTGTTGAGAAAGG + Intergenic
1165695796 19:37899986-37900008 GGCCTGGGCTTCCTGAAGCAAGG + Intronic
1166130205 19:40741522-40741544 GGCCTGTTCCTCCTTCAGAGTGG + Exonic
1167649775 19:50722993-50723015 GGTCTGCCCCTCCTTAGGAATGG + Intergenic
925936631 2:8769230-8769252 TGACTCGACCTCCTTAAGCAAGG + Intronic
934717436 2:96551919-96551941 GGCATCCGCCTCCTTAAGAAAGG - Exonic
936522617 2:113220590-113220612 TGCCTGGACCTTCTGGAGAAGGG + Intronic
940273565 2:151916217-151916239 GGCCTGAAAAACCTTAAGAAAGG - Intronic
941947115 2:171111606-171111628 GGCCTGGAGCTTATTTAGAATGG - Intronic
947632419 2:231662670-231662692 CGCCTCTACCTCCTCAAGAAGGG + Intergenic
1169957356 20:11119387-11119409 GTCCTGGACCTACCTCAGAAAGG + Intergenic
1170542766 20:17405610-17405632 GGCCTGCACCACGCTAAGAAAGG - Intronic
1171346826 20:24471399-24471421 GGTGTGGACCTCCAAAAGAACGG - Intronic
1171352163 20:24511542-24511564 GGCCTGGGTCCCCTCAAGAAGGG - Intronic
1171953344 20:31440759-31440781 AACCTGAACCTCCTTAAGGAAGG + Intronic
1175803744 20:61815701-61815723 GGCCTGGACCTCCCTCAGCCGGG - Intronic
1181381492 22:22508367-22508389 GGCCCGGGCCTCCTGGAGAAGGG - Intronic
1185354663 22:50360610-50360632 TGCCTGGACCTCCCAAAGCATGG + Intronic
949296834 3:2534472-2534494 GTCCTGGCATTCCTTAAGAATGG + Intronic
950923419 3:16717110-16717132 GCACTGCACCTCCCTAAGAAGGG - Intergenic
956120909 3:65964870-65964892 GGCCTGGACATCCACAAAAAGGG - Intronic
959181753 3:102989109-102989131 GACCTGGATCTCCTTAATATGGG + Intergenic
960344620 3:116517540-116517562 GGCCTGTACCTCCTGAAAGAAGG + Intronic
962270678 3:133975770-133975792 GGCCTGAATCTGGTTAAGAATGG - Intronic
966494922 3:180568972-180568994 AGCATTTACCTCCTTAAGAAAGG - Intergenic
968456633 4:703850-703872 GGTCTGCACCTCCTTGAGGAGGG + Intergenic
974420153 4:61662722-61662744 GGGCTGGACTGCCTGAAGAATGG + Intronic
976895397 4:90104091-90104113 GGCCTGGACCCTCCTCAGAATGG + Intergenic
981813138 4:148798507-148798529 GGCCTGGGCCACTTTGAGAAAGG + Intergenic
986264638 5:6181345-6181367 TGCCTGCACCTCCTTCAGGATGG - Intergenic
988019616 5:25606483-25606505 GGCCTACACCTCTATAAGAAAGG - Intergenic
997967627 5:138371902-138371924 GGCCTTGAACTCCTGAACAAGGG - Intronic
998175837 5:139901510-139901532 GTCCTGGACAGCCTAAAGAAGGG + Intronic
998467360 5:142356795-142356817 GGCCGGGACGTCCTTCAGATTGG + Intergenic
1001781118 5:174369950-174369972 GGCCTCCCCCTCCTTAAGAATGG - Intergenic
1001781128 5:174369983-174370005 AGCCTCCCCCTCCTTAAGAATGG - Intergenic
1001969862 5:175946931-175946953 GGCATGGACCTTCTTATTAAAGG - Intronic
1002247576 5:177896837-177896859 GGCATGGACCTTCTTATTAAAGG + Intergenic
1002895546 6:1378248-1378270 GGCTTGGACGGCCTTCAGAAAGG - Intergenic
1005926860 6:30451869-30451891 GGCCAGGTCCTCCTTAAGAGAGG - Intergenic
1014254507 6:119147716-119147738 GGCCAGGACCTGATTAATAACGG + Intronic
1018177149 6:161186859-161186881 AGGCTGGACATCCTTTAGAAAGG - Intronic
1021886699 7:25146465-25146487 TGCAGGGACCTCCTTTAGAAAGG - Intronic
1022228251 7:28385923-28385945 GGCCTGCACTTCCATCAGAATGG + Intronic
1022835043 7:34105346-34105368 GCTCTGGACTTCCTTAGGAAAGG + Intronic
1024086400 7:45895046-45895068 GGGCTGGGCCCCCTTGAGAAAGG - Intergenic
1029611797 7:101630539-101630561 CGCCTGGACCTGCTACAGAAGGG + Intergenic
1033911612 7:146269876-146269898 GGACTTGACTTCCCTAAGAAAGG - Intronic
1034398757 7:150847594-150847616 GGCCTGGACCTCCTTAAGAAAGG + Intronic
1035901622 8:3462949-3462971 AGCCTGGACATCCTTCACAAGGG - Intronic
1036702466 8:11022154-11022176 GGGTTGGACCTCTTTAAGAGAGG - Intronic
1040599643 8:48870805-48870827 GTCCTGGCCCTGCTTAAGAGGGG - Intergenic
1045685089 8:104703430-104703452 GGCCTGCACCTCCATTTGAATGG - Intronic
1047370303 8:124250750-124250772 GGCCTGGTCCACATAAAGAAAGG + Intergenic
1049016587 8:139924405-139924427 TGCCAGAACCTCCTTAGGAAAGG + Intronic
1049034764 8:140066387-140066409 GGCTGTGAGCTCCTTAAGAATGG + Intronic
1061700791 9:132413972-132413994 GGCCTTGATCTCCTCAAAAAAGG - Intronic
1186025929 X:5311954-5311976 GGTCTGTCCCTCGTTAAGAAAGG + Intergenic