ID: 1034398978

View in Genome Browser
Species Human (GRCh38)
Location 7:150848881-150848903
Sequence TGTCACAGAGGACCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 2, 2: 5, 3: 71, 4: 565}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034398978_1034398989 25 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398989 7:150848929-150848951 GGATAGAGTCCCAGGACTTGGGG No data
1034398978_1034398981 -10 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398981 7:150848894-150848916 CTCTGTGACAGCAGCCATGGAGG No data
1034398978_1034398987 23 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398987 7:150848927-150848949 GGGGATAGAGTCCCAGGACTTGG No data
1034398978_1034398990 26 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398990 7:150848930-150848952 GATAGAGTCCCAGGACTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1034398978_1034398985 4 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398985 7:150848908-150848930 CCATGGAGGCTACTGCAGAGGGG No data
1034398978_1034398988 24 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398988 7:150848928-150848950 GGGATAGAGTCCCAGGACTTGGG No data
1034398978_1034398986 17 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398986 7:150848921-150848943 TGCAGAGGGGATAGAGTCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 200
1034398978_1034398983 3 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398983 7:150848907-150848929 GCCATGGAGGCTACTGCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 173
1034398978_1034398982 2 Left 1034398978 7:150848881-150848903 CCTGTGTGTGGTCCTCTGTGACA 0: 1
1: 2
2: 5
3: 71
4: 565
Right 1034398982 7:150848906-150848928 AGCCATGGAGGCTACTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034398978 Original CRISPR TGTCACAGAGGACCACACAC AGG (reversed) Intronic
900103266 1:971770-971792 AGTCACTGAGGAACAAACACAGG + Intronic
900744098 1:4349336-4349358 TGTGACAAATGGCCACACACAGG + Intergenic
901376537 1:8843652-8843674 TGTAACAAATGACCACAGACTGG - Intergenic
901528478 1:9839015-9839037 TGTAACAAAGTACCACACACTGG - Intergenic
902126528 1:14217245-14217267 TGTTACAGAATACCACAGACTGG - Intergenic
902446113 1:16465648-16465670 TGTAACAAGTGACCACACACTGG + Intergenic
904951266 1:34241047-34241069 AGTCACAGAAGAACATACACAGG - Intergenic
906115806 1:43356398-43356420 TGTAACAAAGTACCACAAACTGG - Intergenic
906535677 1:46549858-46549880 GGTCACAGACGAGCACACAAAGG + Intronic
906824377 1:48963052-48963074 TATCACAGAATACCACAGACTGG + Intronic
907309605 1:53531693-53531715 TGTCACAGAGGGAGACACAGGGG + Intronic
907557780 1:55359615-55359637 TATCACAAAGCACCACAAACTGG - Intergenic
907563838 1:55416220-55416242 TGTAACAGAATACCACAGACTGG - Intergenic
907582832 1:55587420-55587442 TGTAACAAAGAACCACAAACTGG + Intergenic
907805404 1:57814207-57814229 TGTCACATAGAAAGACACACGGG - Intronic
908190221 1:61695653-61695675 TCTCACAGAGGATCACACAGAGG + Intronic
908933746 1:69348269-69348291 TATGGCAAAGGACCACACACTGG + Intergenic
909354667 1:74695120-74695142 TATCACAGAAGAACACACAGAGG - Intergenic
909538902 1:76769140-76769162 TGTGACAAAGTACCACAAACTGG + Intergenic
910211955 1:84802673-84802695 TGTCACTGAGCACATCACACAGG + Intergenic
910263431 1:85313608-85313630 TATAACAGAATACCACACACTGG - Intergenic
910815302 1:91286255-91286277 TATAACAAAGTACCACACACTGG + Intronic
910959550 1:92747387-92747409 TGTTACAAAGTACCACAAACTGG + Intronic
911059740 1:93737646-93737668 TGTAACAAATGACCACAGACTGG - Intronic
911165953 1:94724394-94724416 TGTAACAGAATACCACAGACTGG + Intergenic
911232451 1:95375236-95375258 TGTAACAAAGTACCACAGACTGG - Intergenic
911834186 1:102595049-102595071 TGTAACAAATGACCACAAACTGG - Intergenic
912008854 1:104934654-104934676 TATAACAGAGTACCACACACTGG - Intergenic
912202531 1:107474571-107474593 TATAACAGAATACCACACACTGG + Intronic
912582294 1:110731396-110731418 TGTAACAAAGTACCACAAACTGG - Intergenic
912995163 1:114525900-114525922 TGTAACAAATGACCACAAACAGG + Intergenic
914212941 1:145597551-145597573 TGTCAGAGAGAAACAGACACTGG - Intergenic
915362891 1:155296297-155296319 TGTCACAGAGGACCACAGAATGG - Intronic
915538221 1:156550490-156550512 TGCCACACATGCCCACACACAGG - Intronic
916480151 1:165207512-165207534 TGTCACAGATGAGCAAACAAAGG - Intronic
916732516 1:167579392-167579414 TGTAACAAAGCACCACAAACTGG - Intergenic
917294861 1:173507887-173507909 TGTAACAAAGTACCACAAACTGG - Intronic
920156305 1:203954773-203954795 TCTCAATGAGGACCACACATGGG + Intergenic
920196551 1:204231066-204231088 TGTGACAAATCACCACACACAGG - Intronic
922711194 1:227834260-227834282 TGTCACAAAGTACCCCAAACTGG - Intronic
922715819 1:227870995-227871017 TGTAAAAGAACACCACACACTGG - Intergenic
922862877 1:228834352-228834374 TTAAACGGAGGACCACACACTGG + Intergenic
923618835 1:235560516-235560538 TGTAACAGAATACCACAGACTGG - Intronic
924433959 1:244022162-244022184 TGTCAAAGAAGACCACAGTCAGG - Intergenic
1062855308 10:777209-777231 TGTCACAGATTTGCACACACGGG - Intergenic
1063126674 10:3142305-3142327 TGTCACAGAGGGTCACAGATGGG - Intronic
1063536811 10:6891538-6891560 TGTCACAAAGCATCACACACTGG + Intergenic
1063542570 10:6949292-6949314 TGTAACAGAGTACCATAGACTGG + Intergenic
1063634957 10:7773288-7773310 TGTAACAGATTACCACAAACTGG - Intronic
1064136425 10:12754584-12754606 TGTAACAGAATACCACAGACTGG + Intronic
1064623836 10:17242059-17242081 TGTAACAGAATACCACAGACTGG + Intergenic
1064796353 10:19016084-19016106 TATAACAGAGTACCACAAACTGG - Intergenic
1065811963 10:29450699-29450721 TGTGACAAAGTACCACAAACTGG + Intergenic
1066148379 10:32587242-32587264 TGTAACAGAATACCACAGACTGG + Intronic
1067059884 10:43072856-43072878 TGTCACAGAGGATGACACCGAGG + Intergenic
1068145758 10:53068173-53068195 TGTAACAGAATACCACAGACTGG - Intergenic
1069970978 10:72168917-72168939 TGTCATAGAATACCACAGACTGG - Intronic
1070419605 10:76223772-76223794 TATAACAAAGGACCACAGACTGG - Intronic
1070635502 10:78123525-78123547 TGTAACAGAATACCACAGACCGG + Intergenic
1071093466 10:81946947-81946969 TGTGACAAAGCACCACAAACTGG + Intronic
1071177184 10:82940213-82940235 TGTAACAAAGCACCACAAACTGG + Intronic
1071473172 10:86001779-86001801 TCTAACAAAGGACCACAAACTGG + Intronic
1071749937 10:88463495-88463517 TGTAACAAAGTACCACAGACTGG - Intronic
1073450934 10:103608371-103608393 TGTAACAAAGTACCACACACTGG - Intronic
1073468245 10:103706939-103706961 TGTCACAGAGGACGGAGCACAGG - Intronic
1074100608 10:110351988-110352010 TGTGACAGATAACCACAAACTGG - Intergenic
1074224036 10:111466314-111466336 GGTCACAGAGGACTTCACTCAGG - Intergenic
1075002301 10:118807843-118807865 TGCCACAGAATACCATACACTGG - Intergenic
1075234988 10:120719709-120719731 TGTAACAAATGACCACAAACTGG + Intergenic
1075551255 10:123394375-123394397 TGGCAGAGAGCACCCCACACAGG - Intergenic
1075795609 10:125117361-125117383 TGCCACCGAGCACCACACAGTGG + Intronic
1076428641 10:130385407-130385429 TGTCGCAGAGGACTACTTACTGG + Intergenic
1076587010 10:131556197-131556219 CCTCACAGAGCCCCACACACAGG - Intergenic
1076782675 10:132732923-132732945 TGGCTCAGAGGACCACAGGCTGG + Intronic
1077324227 11:1956805-1956827 GGCCAGAGAGGGCCACACACAGG + Intronic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1077874630 11:6293751-6293773 TGTAACAGAATACCACAGACTGG - Intergenic
1078990958 11:16645851-16645873 TGTAACAAAGTACCACAAACTGG - Intronic
1079056803 11:17213298-17213320 CATAACAGAGGACCACAAACTGG + Intronic
1079103518 11:17556379-17556401 TTTCACAAAGGACCACAGTCTGG - Intronic
1079427399 11:20356686-20356708 TGTAACAAATGACCACACACTGG - Intergenic
1080307799 11:30855135-30855157 TATCACAGAATACCACAGACTGG - Intronic
1080750222 11:35144062-35144084 TGTCACCTAGAGCCACACACTGG - Intronic
1080798792 11:35590082-35590104 CAGCCCAGAGGACCACACACAGG + Intergenic
1081274743 11:41134544-41134566 TGTAACAAAGCACCACAGACTGG + Intronic
1081430005 11:42966641-42966663 TGTAACAAATGACCACAAACTGG + Intergenic
1081598308 11:44474508-44474530 TGTCACAGAAGAGCAAACATAGG + Intergenic
1084073705 11:66755630-66755652 TGTAACAAAGTACCACAAACTGG + Intronic
1084330696 11:68428341-68428363 TGTAACAAATGACCACAAACTGG + Intronic
1084936866 11:72591467-72591489 TATCACTGAGGCCCACAGACTGG - Intronic
1088453115 11:110002996-110003018 AGTCACAGAGGAAGACACAGTGG + Intergenic
1089187213 11:116627426-116627448 TGTAACAAAGTACCACAAACTGG + Intergenic
1089899168 11:121963266-121963288 TGTCACATAAGACCTCACCCTGG - Intergenic
1089965117 11:122649354-122649376 TGTAACCGATGACCACAAACTGG - Intergenic
1090036231 11:123251980-123252002 TGTAACAGAGTACCACAAACTGG - Intergenic
1090760987 11:129836758-129836780 GGTAACACAGTACCACACACTGG - Intronic
1090976445 11:131684163-131684185 TGCCTCAGAGCCCCACACACAGG - Intronic
1202807213 11_KI270721v1_random:12000-12022 GGCCAGAGAGGGCCACACACAGG + Intergenic
1091862564 12:3799249-3799271 TGTAACAGAATACCACAGACTGG - Intronic
1092839263 12:12523447-12523469 TCTCACAGAGGCTGACACACAGG + Intronic
1092967680 12:13660218-13660240 TGGGGGAGAGGACCACACACAGG + Intronic
1093626652 12:21357285-21357307 GGTCACAGAGACACACACACAGG + Intronic
1093763592 12:22937684-22937706 TGTAACAGAGTACCACAAACTGG - Intergenic
1093974874 12:25410588-25410610 TGTAACAAAGTACCACAAACTGG - Intronic
1094318684 12:29160580-29160602 TGTAACAAAGTACCACAAACTGG + Intronic
1095373477 12:41498349-41498371 TGTAACAGAATACCACATACTGG + Intronic
1096514258 12:52147553-52147575 ACTCACAGAGATCCACACACTGG + Intergenic
1097448145 12:59700741-59700763 GGTCAGAGAGGAACACACAGAGG + Intronic
1099054362 12:77820267-77820289 TATAACAGAGTACCACAGACTGG + Intergenic
1099161034 12:79242135-79242157 TGTAACAAATGACCACAAACTGG - Intronic
1099407176 12:82278996-82279018 TGTAACAGAGTACCACAGACTGG - Intronic
1100216993 12:92461362-92461384 TGTCACAAAGTACCATAGACTGG + Intergenic
1100297363 12:93275314-93275336 TGTAACAAAGTACCACACACTGG - Intergenic
1100307728 12:93366608-93366630 TGTGTCAGAGGAACACACCCTGG - Intergenic
1100969813 12:100056353-100056375 TATCACAGAATACCACAGACTGG - Intronic
1101039196 12:100736985-100737007 TGTGACAAAGTACCACAAACTGG - Intronic
1101257289 12:102990925-102990947 TGTAACAAAGTACCACAGACAGG + Intergenic
1101395107 12:104340404-104340426 TGTAACAAAGTACCACAAACTGG + Intronic
1101751770 12:107587878-107587900 AGTTACAAAGTACCACACACTGG + Intronic
1102783175 12:115583249-115583271 TGTCTCTAAGCACCACACACAGG + Intergenic
1102844154 12:116160713-116160735 AGGCACACATGACCACACACAGG + Intronic
1103033912 12:117641014-117641036 TGTAACAAAGTACCACAAACTGG + Intronic
1103166376 12:118773811-118773833 TGTAACAGATGACCACAAACTGG - Intergenic
1103829530 12:123767859-123767881 TGTCACAAGTGACCACAGACTGG + Intronic
1103891631 12:124243260-124243282 TGGAACAGAGGCGCACACACAGG + Intronic
1104280899 12:127375974-127375996 TGTCAGAGGGGTCAACACACAGG + Intergenic
1104328910 12:127826009-127826031 TGTAACAGAAGGCCACAGACCGG - Intergenic
1104396186 12:128435232-128435254 CATCACAGAGTACCACTCACTGG - Intronic
1104485528 12:129148674-129148696 TGTAACAAATAACCACACACAGG - Intronic
1104598556 12:130136899-130136921 TGTAACTGAGGACCACAAGCTGG - Intergenic
1104924728 12:132308320-132308342 TGTCACAGCTCACCACAGACGGG - Intronic
1105249963 13:18689562-18689584 TGTAACAAAGTACCACAAACCGG - Intergenic
1106224564 13:27775205-27775227 TATGACAGAGTACCACAGACTGG + Intergenic
1106427968 13:29651354-29651376 TGTAACAAAGTACCACACACTGG + Intergenic
1106907077 13:34420420-34420442 TGTCACAAAGCACCACAAACTGG + Intergenic
1107122952 13:36815109-36815131 TGTAATAGAATACCACACACTGG + Intergenic
1107733032 13:43367682-43367704 TGTATCAAAGTACCACACACTGG - Intronic
1107734059 13:43377422-43377444 TATAACAGAGTACCACAGACTGG - Intronic
1107857413 13:44629713-44629735 TGTAACAGAATACCACAGACTGG - Intergenic
1108505349 13:51107933-51107955 TGTAACAAAGCACCACAAACTGG + Intergenic
1108716267 13:53081103-53081125 TGTAACAAAGCACCACAAACAGG - Intergenic
1108790211 13:53961022-53961044 TATAACAGAAGACCACAGACTGG - Intergenic
1108890978 13:55258993-55259015 AGTCACAGCTGACCTCACACAGG - Intergenic
1109202454 13:59446022-59446044 TGTCACATAGTACCACAAGCTGG + Intergenic
1109492813 13:63126167-63126189 CTTAACAGAGGACCACAAACTGG + Intergenic
1110260098 13:73475151-73475173 GGTCAAAGATGACCACACAGAGG + Intergenic
1110509161 13:76328698-76328720 TGTAACAAAGGACCACAGAATGG + Intergenic
1110533273 13:76621640-76621662 TGTAACAGAATACCACAGACTGG + Intergenic
1111041834 13:82758249-82758271 TGTTAAAGAGCACAACACACAGG + Intergenic
1111622946 13:90747547-90747569 TGTAACAAAGTACCACAAACTGG + Intergenic
1111927712 13:94480880-94480902 TGTAACAAATGACCACAAACTGG + Intergenic
1112862594 13:103850997-103851019 TGTAACAGAATACCACAGACTGG + Intergenic
1112865682 13:103894054-103894076 TGTAACAAAGCACCACAAACTGG + Intergenic
1112897547 13:104319576-104319598 TATAACAGAGCACCACACACTGG + Intergenic
1113096315 13:106667498-106667520 CATCACAGAAGACCACAGACTGG + Intergenic
1113223692 13:108134953-108134975 TGTAACAAAGTACCACAAACTGG - Intergenic
1113360166 13:109623198-109623220 TGTCACAAATGACCACAAACTGG - Intergenic
1113613543 13:111664919-111664941 TGTGGCAAAGCACCACACACTGG - Intronic
1114326987 14:21599454-21599476 GGTCACAGAGGAAAACACAAGGG + Intergenic
1115039001 14:28898143-28898165 TGTCACAGAGGATTTCTCACAGG - Intergenic
1115874536 14:37845500-37845522 TGTCAGAGTGGAGCACATACGGG - Intronic
1117444071 14:55787057-55787079 TGTAACAGAGTACCACAAACTGG + Intergenic
1119456492 14:74760451-74760473 TGTAACAAAGCACCACAAACTGG + Intergenic
1119560796 14:75588155-75588177 TGTCACAGAATACCACAGACTGG + Intronic
1119561590 14:75594481-75594503 TATCACAGAATACCACAGACTGG + Intronic
1119863580 14:77954883-77954905 TATCACAAAGTACCACAGACTGG + Intergenic
1119993338 14:79224956-79224978 TGTAACAAAGAACCACAAACTGG - Intronic
1120148534 14:81006227-81006249 TGTCACAAAGCCCCACAGACTGG + Intronic
1120418798 14:84255577-84255599 TTTAACAAAGGACCACAAACTGG - Intergenic
1120455795 14:84728938-84728960 TGTGACAGAGCACCATAGACTGG - Intergenic
1121327696 14:93031103-93031125 TGTCACAAAGGGCCACAAACTGG - Intronic
1121626329 14:95388032-95388054 TGTAACAAATGACCACAGACTGG + Intergenic
1121800383 14:96769469-96769491 TGTCACAAAGCACCACAAACTGG + Intergenic
1121816971 14:96936057-96936079 TAGCTCAGAGGACCAGACACTGG + Intergenic
1122120438 14:99550502-99550524 TGTCACACATGACTACACCCTGG - Intronic
1122290112 14:100676194-100676216 AGTCACAGAGAACCACAGAGAGG - Intergenic
1122394595 14:101414623-101414645 CGTGACAGATGACCACAAACTGG - Intergenic
1122725904 14:103752012-103752034 GGTCACAAAGGACCGCATACAGG + Intronic
1123018789 14:105387903-105387925 TGTCACAGATTTCCAAACACTGG + Intronic
1123792957 15:23741189-23741211 TGTAACAGAGCACCACAGACTGG + Intergenic
1123984708 15:25635141-25635163 TGTAACAGAGCACCACAGACTGG + Intergenic
1123993693 15:25703547-25703569 TGTCACACAATACCACAGACTGG - Intronic
1124711281 15:32014346-32014368 GTTCACAGAGAAACACACACTGG + Intergenic
1125118475 15:36123731-36123753 TGTGACACAGGCCTACACACAGG + Intergenic
1126707994 15:51424740-51424762 TGACACAGGGGCCCATACACTGG + Intergenic
1127103796 15:55592148-55592170 TATAACAGAGCACCACAGACTGG + Intergenic
1127308145 15:57728196-57728218 TGTCACCAAGGCCCTCACACTGG + Intronic
1127791969 15:62406130-62406152 TGTAACAAAGTACCACATACTGG + Intronic
1128530958 15:68447430-68447452 TGCCACATAGGGCCACACAGGGG + Intergenic
1129163790 15:73763609-73763631 TGTAACAGAATACCACAGACTGG + Intergenic
1129293439 15:74586002-74586024 TTTCACAGAGGGCCAGCCACAGG + Intronic
1129675300 15:77630082-77630104 TTCCACAGAGTGCCACACACAGG + Intronic
1129923826 15:79344297-79344319 TGTAACAAATGACCACAAACTGG + Intronic
1130864930 15:87924810-87924832 TGTCACACAGGACAGCACACAGG + Intronic
1130938129 15:88487376-88487398 TGTGACAAATGACCACACCCTGG - Intergenic
1131406851 15:92171985-92172007 GGCCTCAAAGGACCACACACTGG - Intronic
1132999995 16:2845204-2845226 TTTCACTGAGGACCCCATACAGG - Intergenic
1133821099 16:9237258-9237280 TGTAACAGAGCACCATAGACTGG + Intergenic
1134236721 16:12472184-12472206 AGACCCAGAGGAGCACACACTGG + Intronic
1134299969 16:12981996-12982018 TGTAACAAAGTACCACAGACTGG - Intronic
1135169216 16:20168436-20168458 TATCACAGAGTACCTAACACTGG - Intergenic
1135499078 16:22978192-22978214 TATCACAGAGCACCATAGACTGG + Intergenic
1135790634 16:25391321-25391343 TATCACAGAACACCACAGACTGG + Intergenic
1136286825 16:29249025-29249047 TGTAACAGAGGACCACACACCGG + Intergenic
1137419042 16:48315337-48315359 TGTAACAGAATACCACAGACTGG + Intronic
1137489345 16:48918654-48918676 TGGCACACAGGGCCACACAGGGG - Intergenic
1138682156 16:58692723-58692745 TGTAACAGAATACCACAGACTGG - Intergenic
1140207643 16:72946817-72946839 TTTCTCAGAGGACTACACCCTGG - Intronic
1140420544 16:74815435-74815457 TGTAACAGAATACCACAGACTGG - Intergenic
1140460891 16:75138877-75138899 CATCACAAAGGACCACATACTGG - Intergenic
1140715755 16:77724006-77724028 CATAACAGAGTACCACACACTGG + Intronic
1141128158 16:81415921-81415943 CGTAACAGACTACCACACACTGG + Intergenic
1141473938 16:84259289-84259311 TGTAACAGAGTACCACAGACTGG + Intergenic
1141585661 16:85031999-85032021 TCTCACAAAGAACCACGCACTGG + Intronic
1142092424 16:88221660-88221682 TGTAACAGAGGACCACACACCGG + Intergenic
1142118057 16:88370663-88370685 TGTCACAAATGACCGCAAACTGG + Intergenic
1142201034 16:88761272-88761294 TTTCACAGATGAGCACACAGAGG + Intronic
1142250784 16:88990917-88990939 TGTCACTGAGGCACACACTCAGG - Intergenic
1146206411 17:30908703-30908725 TGTAACAAATGACCACAAACTGG - Intronic
1146637026 17:34514123-34514145 TGGCAGTGAGGACCACACAGAGG - Intergenic
1148390035 17:47265304-47265326 TGTAACAAAGCACCACAAACTGG + Intronic
1148405472 17:47410085-47410107 TGTAACAGAATACCACAGACTGG + Intronic
1148664533 17:49364383-49364405 TGTAACAGAATACCACAGACTGG - Intergenic
1149000253 17:51749793-51749815 TGACAGAGGAGACCACACACTGG + Intronic
1149259228 17:54860712-54860734 TGCCACACAGGCCCACAGACAGG + Intergenic
1149381750 17:56101221-56101243 TGTAACAGAATACCATACACTGG - Intergenic
1150549725 17:66198256-66198278 TGTCCCAGCGGATCACAAACCGG + Intergenic
1150574908 17:66421903-66421925 TGTGACAGAGTACCACAGACTGG + Intronic
1151549899 17:74816278-74816300 TATCACAGATGACCACAAACTGG - Intronic
1152155605 17:78630675-78630697 TGTAATAGAGGAACACAAACTGG - Intergenic
1152256746 17:79244437-79244459 CGTAACAGATGACCACAAACTGG - Intronic
1152260551 17:79264577-79264599 TGTGACAGATGACCACGAACTGG - Intronic
1152335022 17:79695787-79695809 TGTAACAAAAGACCCCACACGGG - Intergenic
1152390353 17:80000584-80000606 TGTGACAAAGGACCACAAACCGG - Intronic
1152478028 17:80531086-80531108 TGTAACAAAGTACCACAAACTGG - Intergenic
1152857290 17:82672778-82672800 TGTAACAGAATACCACAAACTGG - Intronic
1153132107 18:1865959-1865981 TGACACACTGGACCAGACACAGG + Intergenic
1154438863 18:14369334-14369356 TGTAACAAAGTACCACAAACTGG + Intergenic
1155591520 18:27433107-27433129 TATCACAGAATACCACAAACTGG - Intergenic
1156260287 18:35439829-35439851 TGTAACAAAGCACCACAAACTGG - Intergenic
1157084392 18:44564123-44564145 TGTAACAGAGTACCACAAACTGG - Intergenic
1157395229 18:47335694-47335716 TTTCCCAGAGGACTTCACACTGG + Intergenic
1157537166 18:48468388-48468410 TGTAACAAAGCACCACAAACTGG - Intergenic
1157578043 18:48756930-48756952 TGTAACAGAGTACCACTGACTGG + Intronic
1157772795 18:50364483-50364505 TGTAACAGAATACCACAGACTGG + Intergenic
1157883198 18:51341626-51341648 TGTGACAAAGGACCACAGACTGG - Intergenic
1158322388 18:56277785-56277807 TGTTACACAGTACCACAAACTGG - Intergenic
1158415683 18:57247923-57247945 TGTAACAAAGTACCACAAACTGG + Intergenic
1158717671 18:59894941-59894963 TGTAACAAAGTACCACAGACTGG - Intergenic
1158947278 18:62457959-62457981 TGTAACAGGGAACGACACACTGG - Intergenic
1160029058 18:75242970-75242992 TGTCCCTGAGGTGCACACACTGG + Intronic
1160090987 18:75826332-75826354 TGTAACAAAGCACCACAGACTGG + Intergenic
1160542058 18:79629250-79629272 TGGCACGGGGGACCACACCCGGG + Intergenic
1161243909 19:3238415-3238437 TGTAACAAATGACCACAAACTGG + Intronic
1161437433 19:4272298-4272320 TTTCACAGAACACCACAGACTGG + Intergenic
1162234952 19:9301514-9301536 TGTAGCAGAGTATCACACACTGG - Intronic
1163496681 19:17650076-17650098 TGTCACAAAGTACCACAGACGGG - Intronic
1163687628 19:18720933-18720955 TGTAACAAATGACCACAAACTGG + Intronic
1164450367 19:28357072-28357094 TGTAACAGAGCACCACAGCCTGG + Intergenic
1164510948 19:28896853-28896875 TGTCAAAGAGGACCACACATGGG + Intergenic
1164760504 19:30724965-30724987 TGTCACAGAGTACCATAGCCTGG - Intergenic
1165124143 19:33582122-33582144 TGTAACAGAATACCACAGACTGG - Intergenic
1165305810 19:35002025-35002047 TGTCACAAAGGAATACACAAGGG - Intronic
1165331984 19:35145144-35145166 TCTCACACAGGACCTCACAGGGG + Intronic
1165988722 19:39793227-39793249 TGGCACAGAGGACCACAGCCTGG - Intergenic
1167533328 19:50032654-50032676 TGTAACAAAGTACCACACACTGG + Intronic
925131316 2:1496052-1496074 TGTCACAGATGACCCGAGACAGG - Exonic
925166413 2:1718647-1718669 TGCCACAGGGCAGCACACACGGG + Intronic
925166417 2:1718671-1718693 TGACACAGAGCAGCAAACACGGG + Intronic
925311442 2:2887021-2887043 TGTAACACAGGTCCACAAACTGG + Intergenic
925588960 2:5491254-5491276 CATCCCAAAGGACCACACACTGG - Intergenic
925690040 2:6512326-6512348 TGTAACAGACTACCACACACTGG - Intergenic
927134726 2:20088358-20088380 TGTGACAGAATACCACAGACTGG - Intergenic
927327043 2:21817014-21817036 TGATAAAGAGGATCACACACAGG - Intergenic
927922743 2:26986012-26986034 TGTGACAAATGACCACAAACTGG - Intronic
928191107 2:29169155-29169177 TGTGACAAAGTACCACAGACTGG + Intronic
928395894 2:30943160-30943182 TGTAACAGCATACCACACACGGG - Intronic
928622668 2:33106985-33107007 TGTCACAGGGGACCACACAAAGG - Intronic
929007371 2:37409369-37409391 TGTAACAAAGTACCACCCACTGG + Intergenic
929386089 2:41408992-41409014 AGTCACACTGGACCACACAGGGG - Intergenic
931258611 2:60597256-60597278 TTTCACACAGGCACACACACGGG + Intergenic
932297589 2:70640014-70640036 TGTAACAGAGCACCACAAACTGG + Intronic
932412177 2:71553998-71554020 TGTCTCAGACCACCACCCACTGG + Intronic
933939521 2:87233781-87233803 TGTAACAGAATACCACATACAGG - Intergenic
935039289 2:99410496-99410518 TTTCAGCGAGGCCCACACACAGG - Intronic
935655573 2:105420086-105420108 CATCACAAAGTACCACACACTGG + Intronic
935741397 2:106151598-106151620 TGTAACAGATTACCACAGACTGG - Intronic
935986137 2:108675167-108675189 TGTAACAGAATACCACAAACTGG + Intronic
936138578 2:109918782-109918804 TGTAACAGAATACCACAAACTGG + Intergenic
936206118 2:110452703-110452725 TGTAACAGAATACCACAAACTGG - Intronic
936353614 2:111731992-111732014 TGTAACAGAATACCACATACAGG + Intergenic
936598479 2:113872588-113872610 TGTAACAAAGTACCATACACTGG - Intergenic
937139170 2:119583972-119583994 TGTCACAGAATACCACAGACTGG - Intronic
937243890 2:120479931-120479953 GTTCACAGAAGACCAAACACAGG - Intergenic
937256564 2:120560245-120560267 TGTCAAGGAGGCCCTCACACAGG - Intergenic
937528424 2:122799512-122799534 TGTAACAAAGTACCACACACTGG + Intergenic
937840962 2:126524247-126524269 TGTCACAGAATGCCACAGACTGG + Intergenic
938620829 2:133051182-133051204 AGTCTCTGAGGACCACACAGAGG - Intronic
939194145 2:138951638-138951660 TGTCACAGAATACCTCAGACTGG - Intergenic
939612216 2:144325365-144325387 CGTCACAGAATACCACACTCTGG + Intronic
939742156 2:145921876-145921898 GGTAACAAAGGACCACAGACTGG - Intergenic
941717096 2:168775950-168775972 TGTAACAGAATACCACACACTGG + Intergenic
942174376 2:173317776-173317798 TATCACAGAATACCACAGACTGG + Intergenic
943475164 2:188345412-188345434 TGTCTCAGAGGACAAGAAACAGG + Intronic
943862354 2:192884140-192884162 TCTAACAGAGTACCACAGACTGG + Intergenic
944315036 2:198275648-198275670 TGTAACAGAGTACCACAAACTGG + Intronic
944631382 2:201628884-201628906 TGTAACAAAGTACCACACACTGG - Intronic
945124225 2:206490300-206490322 TGCCACAAAGTACCACAGACTGG - Intronic
946460828 2:219867104-219867126 TGTAACAAAGTACCACAAACTGG + Intergenic
947078219 2:226367097-226367119 TGTAACAAAGCACCACAGACTGG - Intergenic
947321723 2:228926542-228926564 TGTAACAAAGTACCACAGACTGG - Intronic
948097158 2:235344541-235344563 TCTCACACAGGCACACACACAGG + Intergenic
948303819 2:236931852-236931874 TGCCACCAAGGACCACACAGAGG + Intergenic
1169324259 20:4662449-4662471 AGTCACAAAAGACTACACACTGG + Intergenic
1169769955 20:9189614-9189636 TGTAACAGAATACCACAGACTGG + Intronic
1170116971 20:12871007-12871029 ATTCCCAGTGGACCACACACTGG - Intergenic
1171194540 20:23186998-23187020 TGTCACCAAGGAACACACCCCGG + Intergenic
1171338946 20:24412138-24412160 TGTGCGAGAGGAACACACACAGG - Intergenic
1172174433 20:32963523-32963545 GGTAACAGAGCACCCCACACAGG + Intergenic
1173068206 20:39735398-39735420 TTTTACAAAGGACCACAGACTGG - Intergenic
1173364545 20:42372929-42372951 TGTAACAAAATACCACACACAGG - Intronic
1173907902 20:46642104-46642126 TGCCACACAGGGCCACACAGGGG - Intronic
1174306651 20:49618218-49618240 TGTCACTGAGGAACAAAGACTGG - Intergenic
1174505698 20:51016107-51016129 TGTCACAAATTACCACAAACTGG - Intronic
1174727530 20:52878505-52878527 TGTAACAAAGTATCACACACTGG + Intergenic
1175163183 20:57023842-57023864 TGTAACAAATGACCACAAACTGG - Intergenic
1175464280 20:59179413-59179435 AGTAACAAATGACCACACACTGG + Intergenic
1175669906 20:60893126-60893148 TGTAACAAATGACCACAAACTGG - Intergenic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1176293233 21:5057263-5057285 TGCAACAGAGGACCACAGGCGGG + Intergenic
1176456819 21:6920098-6920120 TGTAACAAAGTACCACAAACTGG - Intergenic
1176834992 21:13785158-13785180 TGTAACAAAGTACCACAAACTGG - Intergenic
1178193327 21:30312669-30312691 TGTAACAGAATACTACACACTGG - Intergenic
1178305014 21:31484202-31484224 TGTCACAGAATACCACAGACTGG - Intronic
1178348653 21:31854005-31854027 TGTCACAGTGAATAACACACTGG - Intergenic
1178440042 21:32591324-32591346 GGTCACAGAGGACCTCATTCAGG - Intronic
1178546349 21:33495986-33496008 TGTGACAAAGCACCACAGACTGG - Intergenic
1178750615 21:35299220-35299242 TATCCCAGAGTACCACAAACTGG - Intronic
1178757267 21:35363620-35363642 TGTAACAAAGCACCACAAACTGG - Intronic
1178940506 21:36901454-36901476 TGTCACAAAGGACTACAAACCGG + Intronic
1179047695 21:37861196-37861218 TGTAACAAAGTACCACAAACTGG + Intronic
1179056978 21:37945206-37945228 TCTCACTGAGGACCACACACAGG + Intergenic
1179250954 21:39670929-39670951 TGTAACAGAATACCACAGACTGG + Exonic
1179458880 21:41520268-41520290 TGTTACAGAATACCACAGACTGG + Intronic
1179541788 21:42087723-42087745 TGTAACCAAGGACCACAGACTGG + Intronic
1179864027 21:44206387-44206409 TGCAACAGAGGACCACAGGCGGG - Intergenic
1180117664 21:45721738-45721760 TTTCACAGAGGTCCATAGACAGG + Intronic
1180221108 21:46358544-46358566 TGCCAGAGAAGGCCACACACTGG - Intronic
1181284751 22:21743790-21743812 TGTAACAAAGTACCACAGACTGG - Intergenic
1182192234 22:28473987-28474009 TGTAACAAAGTACCACAAACTGG - Intronic
1182546563 22:31080189-31080211 TGTCACAGAGGACCTGAACCGGG + Intronic
1182606025 22:31504589-31504611 TGTAACAAAGTACCACAAACCGG + Intronic
1183572900 22:38667561-38667583 TGTTACAGATTACCACAGACTGG + Intronic
1184435832 22:44474833-44474855 TGTAACAGAATACCACAGACTGG - Intergenic
1184876249 22:47277503-47277525 TCTCACAGAGGCCCACAGAGAGG - Intergenic
1185226926 22:49658462-49658484 CGTGACAAAGGACCACAAACTGG + Intergenic
949285054 3:2392819-2392841 TGTAACAAAGTACCACAAACTGG + Intronic
949767340 3:7541801-7541823 TGTCACACAGTACCACAAATTGG + Intronic
949935576 3:9113169-9113191 TGTCACACAGGACCATAGAGTGG + Intronic
949963798 3:9337716-9337738 TGTAACAGAATACCACAAACTGG - Intronic
950138137 3:10597385-10597407 AGGCACAGAGGCACACACACAGG + Intronic
950319542 3:12037405-12037427 TGTAACAGAATACCACAGACTGG + Intronic
950462610 3:13134400-13134422 TGCCACAGAGGACCCAAGACTGG - Intergenic
950969435 3:17171372-17171394 TGTAACAGAGTACTACAAACTGG + Intronic
951663913 3:25100774-25100796 TGTCAAAAGGGACAACACACAGG + Intergenic
952568940 3:34690484-34690506 TGTAACAAAGTACCACAGACTGG - Intergenic
952766214 3:36956535-36956557 TGTAACAGAGTACCACAAATGGG - Intergenic
953233836 3:41088561-41088583 TGACACAGGGGACCACACAGCGG + Intergenic
953363336 3:42320413-42320435 TGTAACAAGGTACCACACACTGG - Intergenic
953575130 3:44107200-44107222 TGTCTCAGAGGACCTCACCTGGG + Intergenic
953658295 3:44871482-44871504 TCTCCAAGAGGACCAGACACAGG - Intronic
955064976 3:55526297-55526319 TGTAACAAAGTACCACAAACTGG - Intronic
956236519 3:67078234-67078256 TGTCACAAAATACCACAGACTGG - Intergenic
956717369 3:72090140-72090162 TGTGACAAAGGACCACAAACTGG + Intergenic
956739491 3:72264283-72264305 TGTAACAGAATACCACAGACTGG - Intergenic
956804951 3:72800283-72800305 TGTAACAGAATACCACAGACTGG - Intronic
958259163 3:91359683-91359705 TATAACAGAGTACCACAGACTGG + Intergenic
959589378 3:108060634-108060656 TGGAACAGATGACCACAAACTGG - Intronic
960122205 3:113958380-113958402 GATCACAGAGTACCACACGCAGG - Exonic
960235479 3:115277158-115277180 TGTAACAAAGTACCACAAACTGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961739499 3:129024200-129024222 TGTAACAGAATACCACAGACTGG + Intronic
962177370 3:133168254-133168276 TGTAACAGAATACCACAGACTGG + Intronic
962308580 3:134310239-134310261 TGCCACAGAGCACCACGCAGTGG - Intergenic
962529103 3:136262265-136262287 TCTAACAGAGGGCCACTCACAGG + Intronic
962923133 3:139968647-139968669 TGTAACAGAATACCACAAACTGG - Intronic
962946107 3:140172564-140172586 TGTAACAGAGTACCACAAACTGG + Intronic
963669052 3:148229418-148229440 TGTAACAAAGTACCACAAACTGG + Intergenic
964209959 3:154215554-154215576 TGTAACAGAGTACCATAAACTGG + Intronic
965418489 3:168426952-168426974 TGTAACAAATTACCACACACTGG - Intergenic
965898731 3:173612726-173612748 TGTAACAAAGTACCACAAACTGG + Intronic
965903184 3:173669288-173669310 TGTAACAAAGTACCACAAACTGG + Intronic
966290144 3:178346069-178346091 TGTAACAGAACACCACGCACTGG + Intergenic
967598561 3:191357104-191357126 TGTCCTGGAGGACCACACCCTGG + Exonic
967774760 3:193375050-193375072 TGTAACAGAAGACCACAGACTGG - Intronic
968128537 3:196177871-196177893 TGTAACAAAGTACCGCACACTGG - Intergenic
968468010 4:762683-762705 TGCCACAGAACACCACACACTGG - Intronic
968507291 4:976707-976729 CGTGACAGAAGACCACAGACTGG + Intronic
969667079 4:8565544-8565566 TGACACAGAGGCCCAGATACTGG + Intronic
969685678 4:8672715-8672737 TGTAACAGGGGACTACACTCTGG + Intergenic
969868049 4:10087966-10087988 TGTGCCAGAGGACTACAGACTGG + Intronic
970274718 4:14386035-14386057 TGTAACAGAATACCACAGACTGG + Intergenic
970730060 4:19092023-19092045 TGTGACAGAGGACCACTGAAGGG - Intergenic
971366808 4:25984225-25984247 TATCACAAAGGACCACAGCCTGG + Intergenic
972341100 4:38153437-38153459 TGTAACAGAATACCACACACTGG + Intergenic
972371771 4:38430955-38430977 TGTAACAAAATACCACACACTGG - Intergenic
972406639 4:38752661-38752683 CGCCACAGAGGAACATACACAGG + Intergenic
973207387 4:47575739-47575761 TGTAACAAAGTACCACAGACAGG + Intronic
974419811 4:61658886-61658908 TGTAACAAAGTACCACAAACAGG + Intronic
975509389 4:75176538-75176560 TATAGCAGAGTACCACACACTGG - Intergenic
975717001 4:77214654-77214676 TGGCACAGGGGAACAGACACTGG - Intronic
975939140 4:79620312-79620334 TATAACAGAGTACCACAGACTGG + Intergenic
976224911 4:82788248-82788270 TATAACAGAGTACCACAAACTGG - Intronic
977100327 4:92803797-92803819 TGTAACAGAGTTCCACAAACTGG + Intronic
977138515 4:93337392-93337414 TGACACAGAGGACCTCACTGAGG + Intronic
977540047 4:98306197-98306219 TATAACAGAATACCACACACCGG + Intronic
977907459 4:102494548-102494570 TATCACAGAAAACCACAGACTGG + Intergenic
978812594 4:112868240-112868262 TATAACAGACTACCACACACTGG + Intronic
979312404 4:119219179-119219201 TGTAACAAAGAACCACAAACTGG + Intronic
980981958 4:139662284-139662306 TATAACAGAATACCACACACTGG + Intergenic
981749018 4:148075687-148075709 TGTAACAAAGGACCACAAATTGG - Intergenic
982107707 4:152025064-152025086 TGTCACAGAGTACCACATGCTGG - Intergenic
982363831 4:154553165-154553187 TGTAACAAAGTACCACAAACTGG + Intergenic
982727826 4:158924211-158924233 TGTAACAAAGTACCACAGACTGG - Intronic
983268240 4:165530452-165530474 TGTCATAGATTACCACAGACTGG + Intergenic
983495558 4:168438662-168438684 TGTCACAAAGCACCACAAGCTGG - Intronic
983791036 4:171797598-171797620 TGTAACAGAATACCACAGACTGG + Intergenic
985112440 4:186559917-186559939 TATAACAGAAGACCACAGACTGG + Intergenic
985300311 4:188481454-188481476 TGTAACAGAGTACCACAGACTGG - Intergenic
986100167 5:4600830-4600852 TGTCACAGAGTACCACAAATTGG - Intergenic
986138163 5:5002758-5002780 TGTAACAGAATACCACAGACCGG + Intergenic
986178073 5:5368826-5368848 TATAACAGAATACCACACACTGG + Intergenic
986200541 5:5574481-5574503 TGTCACAGAGTACCACAGCCTGG + Intergenic
986676935 5:10193990-10194012 TGTCACAAAGTACTACAAACTGG - Intergenic
986738171 5:10682705-10682727 TGGCACTGAGGCCCACACACTGG + Intronic
986990693 5:13549531-13549553 TGTAACAAAGTACCACAAACTGG + Intergenic
988058034 5:26125994-26126016 TGTAACAGAATACCACAGACTGG + Intergenic
988209436 5:28184274-28184296 TGTGACAGAATACCACAGACTGG - Intergenic
988653145 5:33175958-33175980 TGTAGCAGAGGACTACACAAAGG - Intergenic
988806388 5:34744756-34744778 TGTAACAAATGACCACAAACTGG + Intronic
989005822 5:36811134-36811156 TGTGACAGAGTACTACAAACTGG - Intergenic
989139886 5:38191824-38191846 TGTGACAGAGGGCTACACAAAGG + Intergenic
989297027 5:39840831-39840853 TGACACAAAGTACCACAAACTGG - Intergenic
989315217 5:40070528-40070550 TATAACAGAGTACCACAAACTGG - Intergenic
990946725 5:61256816-61256838 TGTCACAGGGGAGCAAAAACGGG + Intergenic
990980366 5:61597580-61597602 TGTAACAAAGCACCACAGACTGG + Intergenic
991032362 5:62095971-62095993 TGTGACAAAGTACCACAAACAGG + Intergenic
991966903 5:72101689-72101711 TGTAACAGATTACCACAGACTGG - Intergenic
992762030 5:79958994-79959016 TGTAACAGAATACCACAGACTGG - Intergenic
992905067 5:81337788-81337810 TATAACAGAGGACCACAAACTGG - Intronic
994184474 5:96803067-96803089 TGTAACAAAGTACCACAGACTGG - Intronic
994427667 5:99614197-99614219 TGTAACAGAATACCACAGACTGG + Intergenic
994671376 5:102765598-102765620 TGTAACAAAGTACCACAAACCGG + Intronic
996049335 5:118914420-118914442 TGTAACAGAATACCACAGACTGG - Intronic
996192830 5:120566329-120566351 TGTAACAGAAAACCACAGACTGG - Intronic
997612176 5:135222960-135222982 TGTGACCCAGGGCCACACACAGG + Intronic
997659920 5:135581691-135581713 TGTAACTGAGGACAAAACACTGG - Intergenic
998044831 5:138978292-138978314 AGTCACAAAGCACCACATACTGG - Intronic
998655747 5:144177382-144177404 TGTAACAAAGTACCACAAACTGG + Intronic
999353353 5:150899221-150899243 TGTGACAAAGTACCACAAACTGG - Intronic
999717219 5:154370989-154371011 TGTAACAGAGAACCAAAAACTGG + Intronic
999772536 5:154786429-154786451 TGTCCCAGAGGACCATAGCCAGG - Intronic
999797432 5:155001673-155001695 TGTAACAGAGAATCACAGACTGG - Intergenic
1000242399 5:159420663-159420685 TGTAACAGAATACCACAGACTGG + Intergenic
1001762711 5:174221385-174221407 AGACACAGAGGAACACACTCTGG + Intronic
1002164260 5:177334880-177334902 TGCCACAGAGACCCACATACAGG + Intronic
1002906398 6:1452689-1452711 TGTCACAAAGTACCACAGACTGG + Intergenic
1003051515 6:2785018-2785040 TGGCAAAGTAGACCACACACTGG - Exonic
1003059020 6:2848094-2848116 GGTGAGACAGGACCACACACAGG - Intergenic
1003502352 6:6712959-6712981 TGCAACAGACGTCCACACACAGG - Intergenic
1003644112 6:7900627-7900649 TGTAACAGAAGACCACAGATTGG + Intronic
1003717124 6:8659588-8659610 TGTAACAGAACACCACAGACTGG - Intergenic
1003903038 6:10672858-10672880 TGTAACATAGTACCACAGACTGG - Intronic
1003957710 6:11179510-11179532 TATCACAGAATACCAAACACTGG - Intergenic
1004203330 6:13570162-13570184 TGTCACAGAATACCACAGACTGG + Intergenic
1004233789 6:13855341-13855363 TGTAACAAAGTACCACAAACTGG + Intergenic
1004272053 6:14204388-14204410 TGACTCAGAGGACAACAAACAGG + Intergenic
1004423530 6:15492342-15492364 TTCCACAGAAGAGCACACACAGG - Intronic
1004975982 6:20966955-20966977 TGTAACAAAGTACCACAAACTGG + Intronic
1005353317 6:24958734-24958756 TGTAACAAAGTACCACAAACTGG + Intronic
1005810084 6:29508690-29508712 AATAACAGAGGACCACAAACTGG + Intergenic
1005900034 6:30209554-30209576 TGTAACAGAATACCACAGACTGG - Intronic
1005985424 6:30870786-30870808 AGTCATGGAGAACCACACACTGG + Intergenic
1006036213 6:31214816-31214838 TGTAACAGAATACCACAGACTGG + Intergenic
1006270735 6:32965022-32965044 TATCACAGAATACCACAGACTGG - Intronic
1006433196 6:34010912-34010934 TGTGACAAATGACCACAGACTGG + Intergenic
1007303128 6:40883595-40883617 TACCACAAAGTACCACACACAGG + Intergenic
1007818369 6:44541205-44541227 TGTAACAGAATACCACAGACTGG + Intergenic
1008640435 6:53456886-53456908 GGTCAGAAAGGACCAGACACAGG - Intergenic
1009184619 6:60559686-60559708 TATAACAGAGTACCACACACTGG - Intergenic
1009758497 6:67973068-67973090 TGTCACAGAATATCACAGACTGG - Intergenic
1009758739 6:67976692-67976714 TGTCACAGAATATCACAGACTGG + Intergenic
1010447695 6:75966605-75966627 TGTCACAAAATACCACAGACTGG - Intronic
1010711426 6:79179645-79179667 TATAACAGAGTACCACAGACTGG - Intergenic
1010794254 6:80101060-80101082 TGTCACAAAGCAGCACAAACTGG - Intergenic
1010859843 6:80897222-80897244 AGTCACAGAGGACCAAGAACTGG + Intergenic
1010964169 6:82184030-82184052 TGTAACAGAGTCCCACAGACTGG - Intronic
1011724316 6:90193550-90193572 TGTAACAGAGTACCACAGACTGG - Intronic
1011788024 6:90868041-90868063 TGTAACAAAGTACCACAAACTGG - Intergenic
1012290659 6:97451854-97451876 TGTAACAGAATACCACAGACTGG + Intergenic
1014044093 6:116863879-116863901 TGGAACACAGGACTACACACAGG + Intergenic
1014723661 6:124950131-124950153 TGTAACAAAGTACCATACACTGG - Intergenic
1016180051 6:141134690-141134712 TTACACAGAGGACAACATACTGG + Intergenic
1016341831 6:143070493-143070515 TATCACAGAATACCACAGACTGG + Intronic
1016835762 6:148475280-148475302 TGTAACAGAATACCACAGACTGG + Intronic
1016846206 6:148570837-148570859 TGTAACAAAGTACCACGCACTGG + Intergenic
1016954563 6:149614080-149614102 TATCACAGAATACCACAGACTGG - Intronic
1016982672 6:149867347-149867369 TGTAACAGAATACCACAGACTGG + Intergenic
1017029422 6:150207734-150207756 TGTGACAGAAGACTACAGACTGG + Intronic
1017320867 6:153091550-153091572 TGTCACACAGGATTGCACACAGG + Intronic
1017378056 6:153794155-153794177 TTTTACAGAGGAACACACAAAGG + Intergenic
1017594944 6:156018286-156018308 TATAACAAAGGACCACAAACCGG + Intergenic
1017638573 6:156467502-156467524 TGTAAAAGAAGACCACACACTGG - Intergenic
1017768277 6:157624847-157624869 TGTGACAGAGTACCACAGACCGG + Intronic
1018394309 6:163365802-163365824 GGTTACAGAAGACCACACACAGG - Intergenic
1018468402 6:164073868-164073890 TGTAACAGAATACCACAGACTGG + Intergenic
1018685601 6:166301930-166301952 TTTAACAGAATACCACACACTGG - Intergenic
1018923554 6:168191836-168191858 TGTCACTGTGGCCCACACTCAGG - Intergenic
1019363635 7:619016-619038 CATCACAGAGCACCACAGACTGG + Intronic
1021652343 7:22844490-22844512 TATAACAGAGGACCACAGACTGG + Intergenic
1022156877 7:27669632-27669654 TGTAACAGAACACCACAAACTGG + Intergenic
1022387927 7:29918764-29918786 CGTCACAAAGTACCACAAACTGG - Intergenic
1023845680 7:44118840-44118862 TGTAACAAAGCACCACAAACTGG - Intronic
1023902526 7:44493846-44493868 TGTCACAAAGTACCATAGACTGG - Intergenic
1024039025 7:45535230-45535252 TGTAACAGAATACCACAGACTGG - Intergenic
1024315355 7:48010772-48010794 TGACACACATGACCACAAACGGG + Intronic
1024384436 7:48735414-48735436 TGTAACAGAAGACCTGACACTGG - Intergenic
1026134938 7:67651657-67651679 TGTCAGAGAAGACTACACAGAGG + Intergenic
1026308272 7:69161319-69161341 TGTCACAAAGTACCATAGACTGG - Intergenic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1028653033 7:93171639-93171661 TGTCACAAAGTACTGCACACTGG + Intergenic
1028923018 7:96327468-96327490 TTTAACAGAGTACCACAAACTGG - Intergenic
1029159712 7:98542995-98543017 TGTAACAAAGTACCACAAACTGG + Intergenic
1029295548 7:99537490-99537512 TGTAACAAAGTACCACAAACTGG - Intergenic
1030178458 7:106679155-106679177 TCTTACGGAGGACCACAAACTGG - Intergenic
1030688724 7:112511454-112511476 TGTAACAAAGTACCACAAACTGG + Intergenic
1030778062 7:113561465-113561487 TGTAACAAAGTACCACAAACAGG + Intergenic
1030991830 7:116310292-116310314 TGTAACAAATGACCACAAACTGG + Intronic
1032114780 7:129107694-129107716 TGTAGCAGATGACCACAAACTGG + Intergenic
1033026561 7:137779679-137779701 TGTAACAGAATACCACAGACTGG - Intronic
1033210620 7:139457466-139457488 TTTTACAGACGACCACACAGCGG - Intronic
1033211025 7:139460327-139460349 TGTCACAGATTACCACAGAAAGG + Intronic
1034290578 7:149927910-149927932 TGTAACAGAATACCACACACCGG - Intergenic
1034398978 7:150848881-150848903 TGTCACAGAGGACCACACACAGG - Intronic
1034660494 7:152764923-152764945 TGTAACAGAATACCACACACCGG + Intronic
1035085607 7:156254949-156254971 GGTAACAGAGGACCACAGATGGG - Intergenic
1035746844 8:1967248-1967270 TGTGACACAGTACCACACGCGGG + Intergenic
1036164041 8:6415188-6415210 TGTAACAAAGGACCACAGAATGG + Intronic
1036194318 8:6700702-6700724 TGTAACACAGTACCACACACTGG + Intergenic
1036204240 8:6793753-6793775 TGTCACAAAGTGCCACAGACTGG + Intergenic
1036461299 8:8955303-8955325 TATCACAGAATACCACAGACTGG - Intergenic
1036559822 8:9891854-9891876 TGTAACAAAAGACCACAAACTGG - Intergenic
1036975394 8:13405304-13405326 AGTCACTGAGGACCACAGAGGGG - Intronic
1038315217 8:26478785-26478807 TGTAACAGAATACCACAGACTGG - Intronic
1038754442 8:30327596-30327618 TGTAACAGAATACCACAGACTGG + Intergenic
1038821360 8:30955025-30955047 TGTAACAGAATACCACAGACTGG + Intergenic
1039469365 8:37803782-37803804 TGTCACAGAGGAGCAGGCAATGG + Intronic
1039844384 8:41315619-41315641 CATCACAGAGCACCAGACACAGG + Intergenic
1040804812 8:51382395-51382417 TGTAACAACAGACCACACACTGG - Intronic
1041348729 8:56928243-56928265 TGTTACAAAGGACCACAAACTGG - Intergenic
1042356553 8:67834846-67834868 TGTAACAAAGTACCACAAACTGG + Intergenic
1042458186 8:69029715-69029737 TGTAACAAAGAACCACAAACTGG - Intergenic
1042733547 8:71963178-71963200 TGTAACAGAATACCACAGACCGG + Intronic
1043297719 8:78685833-78685855 TGTAATAGAGTACCACAAACTGG + Intronic
1043735641 8:83739715-83739737 TGTAACAAAGTACCACAAACTGG + Intergenic
1043866144 8:85378066-85378088 TGCCACAGAGGACCACGCAGGGG + Exonic
1044604912 8:94039992-94040014 TGTCACGGAGGAGCAGCCACTGG + Intergenic
1045313379 8:101022967-101022989 TGTAACAGAATACCACAGACTGG - Intergenic
1045643290 8:104275720-104275742 TGACACAGGGGCCCAGACACTGG + Intergenic
1046001354 8:108424397-108424419 TGTAACAAAATACCACACACTGG + Intronic
1046160467 8:110356481-110356503 TGTAACAGACTACCACAAACTGG + Intergenic
1047047754 8:121073817-121073839 TGTAACAAAGCACCACAAACTGG - Intergenic
1047186838 8:122640951-122640973 GAACACAGAGAACCACACACTGG - Intergenic
1047221727 8:122924107-122924129 TGTAACAAAGCACCACAAACTGG + Intronic
1047303919 8:123637979-123638001 TGTTACAAAGTACCACAAACTGG - Intergenic
1047360712 8:124166366-124166388 GGGCACAGAGGACCATAAACAGG + Intergenic
1047909786 8:129515578-129515600 TGTAACATAGTACCACAAACTGG + Intergenic
1048133663 8:131724804-131724826 TGTCATAAATGACCACAAACTGG - Intergenic
1048314471 8:133351918-133351940 TGTAACAAAGTACCACAGACTGG + Intergenic
1049291570 8:141805754-141805776 TGTGACAGATGACCACGAACAGG - Intergenic
1049599804 8:143502215-143502237 TGTCACACAGTAGCACAGACTGG - Intronic
1051227082 9:14910553-14910575 ACTCACAGAGGTACACACACAGG + Intronic
1051346767 9:16158444-16158466 TGTCACACAGGACAAGAAACGGG + Intergenic
1051481708 9:17568954-17568976 TGTAACAGAGGACCACAAACTGG - Intergenic
1051745642 9:20292540-20292562 TGTAACAAAGTACCACAAACTGG + Intergenic
1052715595 9:32112551-32112573 TGTAACAAATTACCACACACTGG - Intergenic
1052819382 9:33126826-33126848 TGCCACACAGGAACACAGACTGG + Intronic
1052999307 9:34568768-34568790 TGTCACACATGACCACCCAGAGG - Intronic
1053861838 9:42395022-42395044 TGTGACAGATGACCACAGATTGG + Intergenic
1054727430 9:68666272-68666294 TGTCACAAAGTATCACAAACTGG + Intergenic
1055538334 9:77273432-77273454 TTTCTCAAAGGACCACACAGAGG + Intronic
1056288827 9:85120353-85120375 TGTAACAGAGTATCACAGACGGG + Intergenic
1056839399 9:89986406-89986428 TGTGACAGAGCACCACAGCCTGG + Intergenic
1056853985 9:90109176-90109198 TATAACAGAATACCACACACAGG + Intergenic
1056910713 9:90697757-90697779 TGTCATTGTGGAGCACACACTGG + Intergenic
1056960908 9:91122163-91122185 TGTAACAGAATACCACAGACTGG + Intergenic
1057667882 9:97060918-97060940 TGCCACAGAGGAGCACACCCTGG + Intergenic
1057835626 9:98442639-98442661 CATCACAAAGTACCACACACTGG + Intronic
1058395575 9:104549710-104549732 TCTCACAGAGTATCACAGACTGG - Intergenic
1058669929 9:107352226-107352248 TTTCCCAGAGGACCACAAAGTGG + Intergenic
1059351647 9:113669672-113669694 TGTCACAGAGGAGCTGCCACTGG - Intergenic
1059524671 9:114979666-114979688 TGTCACAGAATATCACAGACTGG + Intergenic
1060130610 9:121094187-121094209 TGTAACAGACTACCACAGACTGG + Intronic
1060151275 9:121289838-121289860 TATCACAGAGGACCGAACTCAGG + Intronic
1060461559 9:123859936-123859958 GGTGACAGAGGACCACAGAAAGG + Intronic
1062357274 9:136170836-136170858 AGCCACAGAGGACCCCACACTGG + Intergenic
1185558016 X:1036613-1036635 TGTCACAGAATACCATAGACTGG - Intergenic
1185571220 X:1136451-1136473 TGTCACAGAATACCATAGACCGG + Intergenic
1185571259 X:1136686-1136708 TGTCACAGAATACCATAGACTGG + Intergenic
1185618364 X:1437102-1437124 TGTCACAGAATACCACAGACTGG + Intronic
1185637672 X:1564995-1565017 TGTCACAGAACACCATACCCTGG - Intergenic
1185700165 X:2225634-2225656 TGTCACAGAATACCATAGACTGG - Intronic
1185773907 X:2786965-2786987 TGTCACAGAACACCATAGACTGG - Intronic
1185853479 X:3510661-3510683 TATCACAGAATACCACAGACTGG - Intergenic
1185927431 X:4162821-4162843 CGTAACAAAGTACCACACACTGG - Intergenic
1186173671 X:6903335-6903357 TGTCTCAGTGGCCCACAGACAGG + Intergenic
1186177706 X:6942759-6942781 AGACACAGAGAAACACACACAGG + Intergenic
1186229632 X:7439294-7439316 TATAACAAAGGACCACAGACTGG - Intergenic
1186440882 X:9585575-9585597 TGTAACAGAGTGCCACAGACTGG + Intronic
1186745955 X:12569203-12569225 TGTAACAGAATACCACAGACTGG - Intronic
1186769820 X:12806753-12806775 TGTAACAAAATACCACACACTGG + Intronic
1189116619 X:38349667-38349689 TGTAACAGAATACCACAGACTGG - Intronic
1189249209 X:39587074-39587096 TATAACAAAGAACCACACACTGG + Intergenic
1189275220 X:39780559-39780581 CATAACAAAGGACCACACACCGG - Intergenic
1189343178 X:40220022-40220044 TGTAACAAAGTACCACAAACTGG + Intergenic
1190507925 X:51145879-51145901 TGTCACAGTGGAACACAAAACGG - Intergenic
1192543506 X:71994493-71994515 AGTCACATAGGGCAACACACTGG - Intergenic
1194110940 X:89834189-89834211 TAACACACAGGACCACACAAGGG + Intergenic
1194465202 X:94225925-94225947 TATAACAGAGTACCACAAACTGG - Intergenic
1195628914 X:107033452-107033474 TGTAACAAAGTACCACAGACTGG - Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1197863757 X:130996970-130996992 TGTAACAAAGTACCACAAACCGG - Intergenic
1198330489 X:135618180-135618202 TATCACAGAATACCACAGACTGG - Intergenic
1198336439 X:135670816-135670838 TATCACAGAATACCACAGACTGG + Intergenic
1198363191 X:135915810-135915832 TATCACAGAATACCACAGACTGG - Intergenic
1198520984 X:137452145-137452167 TGTAACAGAATACCACAGACTGG + Intergenic
1198573957 X:137989629-137989651 TGTAACAAAGTACCACAAACTGG + Intergenic
1199115667 X:143989193-143989215 TGTAACAGAGTACCACAGACTGG + Intergenic
1199876719 X:151936998-151937020 TATAACAGAGTACCACAGACTGG + Intergenic
1199968784 X:152843341-152843363 TGTAACAGATGACCACAAACTGG + Intronic
1200275174 X:154725232-154725254 TGTAACAAAGTACCACAGACTGG - Intronic
1200463599 Y:3488935-3488957 TAACACACAGGACCACACAAGGG + Intergenic
1201231420 Y:11868369-11868391 TGTAACAGAATACCACAGACTGG - Intergenic
1202590568 Y:26479042-26479064 TGTAACAGAATACCACAGACTGG + Intergenic