ID: 1034399064

View in Genome Browser
Species Human (GRCh38)
Location 7:150849413-150849435
Sequence TATCCACTCTTGAAAGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034399057_1034399064 3 Left 1034399057 7:150849387-150849409 CCCGCCCTCACATCCATTCTAAT 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399055_1034399064 5 Left 1034399055 7:150849385-150849407 CCCCCGCCCTCACATCCATTCTA 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399059_1034399064 -1 Left 1034399059 7:150849391-150849413 CCCTCACATCCATTCTAATGTGT 0: 1
1: 0
2: 3
3: 76
4: 1895
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399052_1034399064 14 Left 1034399052 7:150849376-150849398 CCACTCCCACCCCCGCCCTCACA 0: 1
1: 1
2: 15
3: 250
4: 2084
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399051_1034399064 15 Left 1034399051 7:150849375-150849397 CCCACTCCCACCCCCGCCCTCAC 0: 1
1: 2
2: 29
3: 373
4: 2074
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399056_1034399064 4 Left 1034399056 7:150849386-150849408 CCCCGCCCTCACATCCATTCTAA 0: 1
1: 0
2: 0
3: 7
4: 158
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399058_1034399064 2 Left 1034399058 7:150849388-150849410 CCGCCCTCACATCCATTCTAATG 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399060_1034399064 -2 Left 1034399060 7:150849392-150849414 CCTCACATCCATTCTAATGTGTA 0: 1
1: 0
2: 0
3: 11
4: 200
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399061_1034399064 -10 Left 1034399061 7:150849400-150849422 CCATTCTAATGTGTATCCACTCT 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399054_1034399064 8 Left 1034399054 7:150849382-150849404 CCACCCCCGCCCTCACATCCATT 0: 1
1: 0
2: 2
3: 31
4: 572
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1034399053_1034399064 9 Left 1034399053 7:150849381-150849403 CCCACCCCCGCCCTCACATCCAT 0: 1
1: 0
2: 1
3: 41
4: 545
Right 1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034399064 Original CRISPR TATCCACTCTTGAAAGCGGG TGG Intronic
902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG + Intronic
904223320 1:28991844-28991866 TATCCCCACTTGATAGAGGGAGG - Intronic
905289730 1:36913081-36913103 TATCCACTCTTGTAAGGGACAGG - Intronic
910046962 1:82929174-82929196 TATCAACTTTTGAATGCTGGGGG - Intergenic
917862762 1:179163296-179163318 TAGCCACTCTGGAAAGCAGTTGG + Intronic
923346449 1:233057987-233058009 ACCCCACTCTTGAAAGCAGGTGG - Intronic
1066414918 10:35213065-35213087 GATCCACTCTTGAAACTGGGGGG - Intergenic
1069861775 10:71475957-71475979 TTTCCACTCTTCAAAGCAAGGGG + Intronic
1077116648 11:888194-888216 TTACCACCCTTGAAAGCGTGAGG - Intronic
1077739388 11:4828549-4828571 TATCTATTTTAGAAAGCGGGGGG + Intronic
1085042332 11:73333904-73333926 AATCCTCTCTTGAAGGAGGGAGG - Intronic
1086325877 11:85698827-85698849 TAACCACTCTTGACTGGGGGTGG - Intronic
1089693536 11:120201501-120201523 TATCCCCTCTTTAACGTGGGAGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091710256 12:2734974-2734996 TATCTACCCTTGAAAGGGGATGG - Intergenic
1091998346 12:5013370-5013392 TAGCCACTCTTAAAAGCCTGTGG - Intergenic
1095959004 12:47821898-47821920 TATCCACTCTTGAATGCTCTTGG - Intronic
1102942410 12:116955021-116955043 TTTCCCCTCTTGAAATGGGGGGG + Intronic
1106947260 13:34842438-34842460 TATCCACTCTTGAAAAAGACAGG + Intergenic
1110136503 13:72073774-72073796 TATCCTCACATGGAAGCGGGTGG - Intergenic
1112502365 13:99953001-99953023 TATCCACTCTGTAAAGCAGAGGG - Intergenic
1113871522 13:113562689-113562711 TCCTCACTCTTGAAAGCCGGCGG + Intergenic
1114739519 14:25080888-25080910 TATCCACTCATGAATGGGAGGGG + Intergenic
1137857156 16:51806442-51806464 TCTTCACTCTTGAAATTGGGAGG + Intergenic
1138682033 16:58691508-58691530 TATCCATTCTTGAAAGTATGAGG + Intergenic
1153679384 18:7485721-7485743 TATCCTCTGTTCAAAGTGGGTGG - Intergenic
1162842296 19:13365318-13365340 TGTCCCCTCTTCAAAGCAGGTGG + Exonic
1163331447 19:16640971-16640993 TAACCACACTTGAAAATGGGAGG + Intronic
1166776418 19:45315590-45315612 TCTCCACCCTGGAGAGCGGGTGG + Exonic
932468118 2:71936490-71936512 GATCCACTCTGGGAAGAGGGTGG - Intergenic
939211617 2:139182552-139182574 TATCAACTGTTGATAGTGGGTGG + Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
1169614116 20:7419590-7419612 TCTCCACTCTGGAAACTGGGAGG + Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1176949735 21:15030824-15030846 TATACACTCTGGAAGGCGGTTGG + Intronic
1176949798 21:15031272-15031294 TATACACTCTGGAAGGCGGTTGG + Intronic
1176949833 21:15031522-15031544 TATACACTCTGGAAGGCGGTTGG + Intronic
1184584003 22:45435503-45435525 TCTCCCCACTTGAAAGCAGGAGG - Intergenic
954142368 3:48615068-48615090 TATTCATTATTGAAAGTGGGGGG + Intergenic
956725590 3:72154062-72154084 TATCTACTCTTGAAAGTGGTAGG + Intergenic
969706635 4:8795955-8795977 TATCCTTTGTTGAAAGAGGGAGG + Intergenic
970409756 4:15792946-15792968 TATGCACTCTTAAATGGGGGAGG - Intronic
972312414 4:37893147-37893169 CATCTACTCTAGAAAGCTGGTGG - Intronic
980512456 4:133812279-133812301 CATCCACTCTTGTAAGGAGGAGG + Intergenic
985712548 5:1437668-1437690 GATCCACCCTTGAAAGCCAGAGG - Intronic
992402845 5:76427444-76427466 CATGCACTCTTGAAAGGGGAGGG - Intronic
997243665 5:132327887-132327909 GATTCACCCTTGAAAGCTGGTGG + Intronic
997545376 5:134701807-134701829 TAAGCACTCTAGAAAGAGGGTGG - Intronic
999248885 5:150169808-150169830 TGTCCACTCTCGAATGCTGGAGG - Intronic
999665138 5:153904930-153904952 TATCCCCTCTTGACAGCGATTGG + Intergenic
1001502894 5:172252781-172252803 TGTCCATTCTTGAAAGCAAGAGG - Intronic
1002784176 6:389046-389068 AATTCACTCTTTAAAGGGGGGGG - Intergenic
1006119889 6:31797565-31797587 TATCCTCTCTTGAGAAGGGGAGG - Exonic
1021057171 7:16063480-16063502 TATCCTCTCTTGTAAATGGGTGG + Intergenic
1025075466 7:55938707-55938729 TATCCATGCTTGAAAGCAGATGG - Intronic
1034399064 7:150849413-150849435 TATCCACTCTTGAAAGCGGGTGG + Intronic
1039741134 8:40383796-40383818 TAAACACTCTTGAAAGAGGAAGG + Intergenic
1061100041 9:128485387-128485409 TATCCACTCTGGAATCCTGGAGG + Exonic