ID: 1034400099

View in Genome Browser
Species Human (GRCh38)
Location 7:150856536-150856558
Sequence CCTTCCTGGGCAGAGTCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034400099_1034400108 16 Left 1034400099 7:150856536-150856558 CCCGGGGACTCTGCCCAGGAAGG 0: 1
1: 0
2: 5
3: 31
4: 340
Right 1034400108 7:150856575-150856597 CCTAAGCAACCAAGAGCTGAAGG 0: 1
1: 0
2: 1
3: 18
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034400099 Original CRISPR CCTTCCTGGGCAGAGTCCCC GGG (reversed) Exonic