ID: 1034401170

View in Genome Browser
Species Human (GRCh38)
Location 7:150862587-150862609
Sequence CCTCAGCTCCAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034401170_1034401185 14 Left 1034401170 7:150862587-150862609 CCTCCCTCCCTCTGGAGCTGAGG No data
Right 1034401185 7:150862624-150862646 CCGGCCATGGCACATGGCCCAGG No data
1034401170_1034401182 8 Left 1034401170 7:150862587-150862609 CCTCCCTCCCTCTGGAGCTGAGG No data
Right 1034401182 7:150862618-150862640 AGTGTCCCGGCCATGGCACATGG No data
1034401170_1034401178 1 Left 1034401170 7:150862587-150862609 CCTCCCTCCCTCTGGAGCTGAGG No data
Right 1034401178 7:150862611-150862633 AGCCCCAAGTGTCCCGGCCATGG No data
1034401170_1034401177 -5 Left 1034401170 7:150862587-150862609 CCTCCCTCCCTCTGGAGCTGAGG No data
Right 1034401177 7:150862605-150862627 TGAGGGAGCCCCAAGTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034401170 Original CRISPR CCTCAGCTCCAGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr