ID: 1034401503

View in Genome Browser
Species Human (GRCh38)
Location 7:150864534-150864556
Sequence GTGAGTGTACGTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034401503_1034401511 21 Left 1034401503 7:150864534-150864556 CCCTGAGCACCACGTACACTCAC No data
Right 1034401511 7:150864578-150864600 TTGTCTGACCCTCCTCAACAGGG No data
1034401503_1034401510 20 Left 1034401503 7:150864534-150864556 CCCTGAGCACCACGTACACTCAC No data
Right 1034401510 7:150864577-150864599 GTTGTCTGACCCTCCTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034401503 Original CRISPR GTGAGTGTACGTGGTGCTCA GGG (reversed) Intergenic