ID: 1034401510

View in Genome Browser
Species Human (GRCh38)
Location 7:150864577-150864599
Sequence GTTGTCTGACCCTCCTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034401504_1034401510 19 Left 1034401504 7:150864535-150864557 CCTGAGCACCACGTACACTCACG No data
Right 1034401510 7:150864577-150864599 GTTGTCTGACCCTCCTCAACAGG No data
1034401506_1034401510 11 Left 1034401506 7:150864543-150864565 CCACGTACACTCACGTGAGAGGG No data
Right 1034401510 7:150864577-150864599 GTTGTCTGACCCTCCTCAACAGG No data
1034401503_1034401510 20 Left 1034401503 7:150864534-150864556 CCCTGAGCACCACGTACACTCAC No data
Right 1034401510 7:150864577-150864599 GTTGTCTGACCCTCCTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034401510 Original CRISPR GTTGTCTGACCCTCCTCAAC AGG Intergenic