ID: 1034405342

View in Genome Browser
Species Human (GRCh38)
Location 7:150899109-150899131
Sequence AGCCTTAGCCATGGAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034405335_1034405342 19 Left 1034405335 7:150899067-150899089 CCGGAATTCACAGACATCACTTG No data
Right 1034405342 7:150899109-150899131 AGCCTTAGCCATGGAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034405342 Original CRISPR AGCCTTAGCCATGGAGGCTG GGG Intergenic
No off target data available for this crispr