ID: 1034405792

View in Genome Browser
Species Human (GRCh38)
Location 7:150901667-150901689
Sequence CCTCCACAGTTCCCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034405792_1034405797 -6 Left 1034405792 7:150901667-150901689 CCAGGCTTGGGGAACTGTGGAGG No data
Right 1034405797 7:150901684-150901706 TGGAGGGGGTGTTCCAACCGAGG No data
1034405792_1034405801 13 Left 1034405792 7:150901667-150901689 CCAGGCTTGGGGAACTGTGGAGG No data
Right 1034405801 7:150901703-150901725 GAGGGCGACAGCTTGATCGAAGG No data
1034405792_1034405798 -5 Left 1034405792 7:150901667-150901689 CCAGGCTTGGGGAACTGTGGAGG No data
Right 1034405798 7:150901685-150901707 GGAGGGGGTGTTCCAACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034405792 Original CRISPR CCTCCACAGTTCCCCAAGCC TGG (reversed) Intergenic