ID: 1034405865

View in Genome Browser
Species Human (GRCh38)
Location 7:150902105-150902127
Sequence CAGGACACACAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034405861_1034405865 -6 Left 1034405861 7:150902088-150902110 CCAGATCTCAGAGAATCCAGGAC No data
Right 1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG No data
1034405859_1034405865 9 Left 1034405859 7:150902073-150902095 CCAGAGGTTAAAGCACCAGATCT No data
Right 1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG No data
1034405858_1034405865 10 Left 1034405858 7:150902072-150902094 CCCAGAGGTTAAAGCACCAGATC No data
Right 1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG No data
1034405857_1034405865 21 Left 1034405857 7:150902061-150902083 CCAGGAAGGATCCCAGAGGTTAA No data
Right 1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034405865 Original CRISPR CAGGACACACAGAAGGAAGG AGG Intergenic
No off target data available for this crispr