ID: 1034406950

View in Genome Browser
Species Human (GRCh38)
Location 7:150910822-150910844
Sequence TGCAGAAATGCTCTCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034406950_1034406956 24 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406956 7:150910869-150910891 GGCTCGCCTTGTTTTTGGACTGG No data
1034406950_1034406957 29 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406957 7:150910874-150910896 GCCTTGTTTTTGGACTGGCGAGG No data
1034406950_1034406955 19 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406955 7:150910864-150910886 GAGAAGGCTCGCCTTGTTTTTGG No data
1034406950_1034406954 3 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406954 7:150910848-150910870 AAAAGGGCAGAGGTGAGAGAAGG No data
1034406950_1034406953 -7 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406953 7:150910838-150910860 TTCTGCAGAAAAAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034406950 Original CRISPR TGCAGAAATGCTCTCTCTCC AGG (reversed) Intergenic