ID: 1034406956

View in Genome Browser
Species Human (GRCh38)
Location 7:150910869-150910891
Sequence GGCTCGCCTTGTTTTTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034406950_1034406956 24 Left 1034406950 7:150910822-150910844 CCTGGAGAGAGAGCATTTCTGCA No data
Right 1034406956 7:150910869-150910891 GGCTCGCCTTGTTTTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034406956 Original CRISPR GGCTCGCCTTGTTTTTGGAC TGG Intergenic