ID: 1034407286

View in Genome Browser
Species Human (GRCh38)
Location 7:150913495-150913517
Sequence GAAGACAAAAGCTACACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407286_1034407289 28 Left 1034407286 7:150913495-150913517 CCTTGAGTGTAGCTTTTGTCTTC No data
Right 1034407289 7:150913546-150913568 AAGCCTCACAATCATGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407286 Original CRISPR GAAGACAAAAGCTACACTCA AGG (reversed) Intergenic
No off target data available for this crispr