ID: 1034407287

View in Genome Browser
Species Human (GRCh38)
Location 7:150913533-150913555
Sequence TGTGAGGCTTGGAAGTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407287_1034407291 3 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407291 7:150913559-150913581 ATGTTCTAGGTAGAAAGAAATGG No data
1034407287_1034407292 4 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407292 7:150913560-150913582 TGTTCTAGGTAGAAAGAAATGGG No data
1034407287_1034407293 8 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407293 7:150913564-150913586 CTAGGTAGAAAGAAATGGGAAGG No data
1034407287_1034407294 9 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407294 7:150913565-150913587 TAGGTAGAAAGAAATGGGAAGGG No data
1034407287_1034407289 -10 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407289 7:150913546-150913568 AAGCCTCACAATCATGTTCTAGG No data
1034407287_1034407295 17 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407295 7:150913573-150913595 AAGAAATGGGAAGGGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407287 Original CRISPR TGTGAGGCTTGGAAGTGCAG CGG (reversed) Intergenic