ID: 1034407289

View in Genome Browser
Species Human (GRCh38)
Location 7:150913546-150913568
Sequence AAGCCTCACAATCATGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407287_1034407289 -10 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407289 7:150913546-150913568 AAGCCTCACAATCATGTTCTAGG No data
1034407286_1034407289 28 Left 1034407286 7:150913495-150913517 CCTTGAGTGTAGCTTTTGTCTTC No data
Right 1034407289 7:150913546-150913568 AAGCCTCACAATCATGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407289 Original CRISPR AAGCCTCACAATCATGTTCT AGG Intergenic
No off target data available for this crispr