ID: 1034407290

View in Genome Browser
Species Human (GRCh38)
Location 7:150913549-150913571
Sequence CTACCTAGAACATGATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407290_1034407295 1 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407295 7:150913573-150913595 AAGAAATGGGAAGGGCAAAAAGG No data
1034407290_1034407297 16 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407297 7:150913588-150913610 CAAAAAGGTTTTCTCCAGCAGGG No data
1034407290_1034407296 15 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407296 7:150913587-150913609 GCAAAAAGGTTTTCTCCAGCAGG No data
1034407290_1034407294 -7 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407294 7:150913565-150913587 TAGGTAGAAAGAAATGGGAAGGG No data
1034407290_1034407293 -8 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407293 7:150913564-150913586 CTAGGTAGAAAGAAATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407290 Original CRISPR CTACCTAGAACATGATTGTG AGG (reversed) Intergenic
No off target data available for this crispr