ID: 1034407291

View in Genome Browser
Species Human (GRCh38)
Location 7:150913559-150913581
Sequence ATGTTCTAGGTAGAAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407287_1034407291 3 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407291 7:150913559-150913581 ATGTTCTAGGTAGAAAGAAATGG No data
1034407288_1034407291 -8 Left 1034407288 7:150913544-150913566 CCAAGCCTCACAATCATGTTCTA No data
Right 1034407291 7:150913559-150913581 ATGTTCTAGGTAGAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407291 Original CRISPR ATGTTCTAGGTAGAAAGAAA TGG Intergenic
No off target data available for this crispr