ID: 1034407295

View in Genome Browser
Species Human (GRCh38)
Location 7:150913573-150913595
Sequence AAGAAATGGGAAGGGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034407290_1034407295 1 Left 1034407290 7:150913549-150913571 CCTCACAATCATGTTCTAGGTAG No data
Right 1034407295 7:150913573-150913595 AAGAAATGGGAAGGGCAAAAAGG No data
1034407287_1034407295 17 Left 1034407287 7:150913533-150913555 CCGCTGCACTTCCAAGCCTCACA No data
Right 1034407295 7:150913573-150913595 AAGAAATGGGAAGGGCAAAAAGG No data
1034407288_1034407295 6 Left 1034407288 7:150913544-150913566 CCAAGCCTCACAATCATGTTCTA No data
Right 1034407295 7:150913573-150913595 AAGAAATGGGAAGGGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034407295 Original CRISPR AAGAAATGGGAAGGGCAAAA AGG Intergenic
No off target data available for this crispr