ID: 1034410283

View in Genome Browser
Species Human (GRCh38)
Location 7:150937608-150937630
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034410283_1034410287 -6 Left 1034410283 7:150937608-150937630 CCTGCAGCAGGACGGGAAGTGAG No data
Right 1034410287 7:150937625-150937647 AGTGAGGGGCCGTGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034410283 Original CRISPR CTCACTTCCCGTCCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr